Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627969_at:

>probe:Drosophila_2:1627969_at:434:481; Interrogation_Position=1438; Antisense; GTATTATTGGTCCTGCAGGCCAACG
>probe:Drosophila_2:1627969_at:389:109; Interrogation_Position=1466; Antisense; AGAAGCTTCCCAATAGCACTTACCT
>probe:Drosophila_2:1627969_at:166:705; Interrogation_Position=1485; Antisense; TTACCTGTACAGCTTCGACTATGAG
>probe:Drosophila_2:1627969_at:202:421; Interrogation_Position=1513; Antisense; GAGCAGAATCGCTATGCCACAGGTG
>probe:Drosophila_2:1627969_at:585:55; Interrogation_Position=1541; Antisense; ATGAGGCCAACTTTGTGCCCTTCGA
>probe:Drosophila_2:1627969_at:111:153; Interrogation_Position=1565; Antisense; ACATGGGTGTCTCACTGACCGACGA
>probe:Drosophila_2:1627969_at:501:37; Interrogation_Position=1643; Antisense; ATCTCAAGGTGGCTCGTCGCATGGT
>probe:Drosophila_2:1627969_at:676:727; Interrogation_Position=1674; Antisense; TTGGACGTCCTTCGCAACAACGGGA
>probe:Drosophila_2:1627969_at:461:407; Interrogation_Position=1746; Antisense; GACGGGACCCTACATGAAGATCGAT
>probe:Drosophila_2:1627969_at:477:57; Interrogation_Position=1802; Antisense; ATGAGTACCGCATCGCCGTGGAGGA
>probe:Drosophila_2:1627969_at:134:209; Interrogation_Position=1831; Antisense; AAGCACGGCTATAACCTGGTCAACG
>probe:Drosophila_2:1627969_at:516:489; Interrogation_Position=1860; Antisense; GTACTACGATCTGCAGGAAGCCCTT
>probe:Drosophila_2:1627969_at:683:255; Interrogation_Position=1987; Antisense; CAAAACTGGGTCTTCATCGCTAGGA
>probe:Drosophila_2:1627969_at:621:493; Interrogation_Position=2013; Antisense; GTCAACGCGCGTCCAGAAACAGTAG

Paste this into a BLAST search page for me
GTATTATTGGTCCTGCAGGCCAACGAGAAGCTTCCCAATAGCACTTACCTTTACCTGTACAGCTTCGACTATGAGGAGCAGAATCGCTATGCCACAGGTGATGAGGCCAACTTTGTGCCCTTCGAACATGGGTGTCTCACTGACCGACGAATCTCAAGGTGGCTCGTCGCATGGTTTGGACGTCCTTCGCAACAACGGGAGACGGGACCCTACATGAAGATCGATATGAGTACCGCATCGCCGTGGAGGAAAGCACGGCTATAACCTGGTCAACGGTACTACGATCTGCAGGAAGCCCTTCAAAACTGGGTCTTCATCGCTAGGAGTCAACGCGCGTCCAGAAACAGTAG

Full Affymetrix probeset data:

Annotations for 1627969_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime