FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627970_at:

>probe:Drosophila_2:1627970_at:189:583; Interrogation_Position=5361; Antisense; TGGCGGCCTGGGTCTAAATCTAACA
>probe:Drosophila_2:1627970_at:98:29; Interrogation_Position=5393; Antisense; ATACGGTCATCTTTGTCGAGCACGA
>probe:Drosophila_2:1627970_at:608:371; Interrogation_Position=5430; Antisense; GAAGGATCTGCAGGCTATGGACCGC
>probe:Drosophila_2:1627970_at:721:229; Interrogation_Position=5485; Antisense; AATGTTTACCGGCTGATCACACGCA
>probe:Drosophila_2:1627970_at:568:381; Interrogation_Position=5583; Antisense; GAACGCTTCGCTGCAGACAATGGGC
>probe:Drosophila_2:1627970_at:448:397; Interrogation_Position=5598; Antisense; GACAATGGGCACCTCACAGATCTTT
>probe:Drosophila_2:1627970_at:456:155; Interrogation_Position=5613; Antisense; ACAGATCTTTGACCTCTTCAACGGA
>probe:Drosophila_2:1627970_at:451:115; Interrogation_Position=5685; Antisense; AGCATCGGGCGGCATGTCCATGAAC
>probe:Drosophila_2:1627970_at:401:685; Interrogation_Position=5715; Antisense; TATCGAGAACTTGCCGGAACTCTGG
>probe:Drosophila_2:1627970_at:397:193; Interrogation_Position=5732; Antisense; AACTCTGGTCCGAGCATCAGTACGA
>probe:Drosophila_2:1627970_at:139:403; Interrogation_Position=5767; Antisense; GACTTGGGCAACTTTGTGCAGGCAC
>probe:Drosophila_2:1627970_at:565:181; Interrogation_Position=5795; Antisense; AAAAGTAGACTACTGCTTCCCACTC
>probe:Drosophila_2:1627970_at:568:95; Interrogation_Position=5822; Antisense; AGACTTCCAGTTTTAGGCTACGTTG
>probe:Drosophila_2:1627970_at:665:19; Interrogation_Position=5854; Antisense; ATATTGCCCTCTGTTCCTTTATAAT

Paste this into a BLAST search page for me
TGGCGGCCTGGGTCTAAATCTAACAATACGGTCATCTTTGTCGAGCACGAGAAGGATCTGCAGGCTATGGACCGCAATGTTTACCGGCTGATCACACGCAGAACGCTTCGCTGCAGACAATGGGCGACAATGGGCACCTCACAGATCTTTACAGATCTTTGACCTCTTCAACGGAAGCATCGGGCGGCATGTCCATGAACTATCGAGAACTTGCCGGAACTCTGGAACTCTGGTCCGAGCATCAGTACGAGACTTGGGCAACTTTGTGCAGGCACAAAAGTAGACTACTGCTTCCCACTCAGACTTCCAGTTTTAGGCTACGTTGATATTGCCCTCTGTTCCTTTATAAT

Full Affymetrix probeset data:

Annotations for 1627970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720