FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627972_at:

>probe:Drosophila_2:1627972_at:213:385; Interrogation_Position=242; Antisense; GAACTACATTGCCTCTGGATCTTTG
>probe:Drosophila_2:1627972_at:382:673; Interrogation_Position=324; Antisense; TACCTGGCCACGTTGAACCTGAAAA
>probe:Drosophila_2:1627972_at:630:175; Interrogation_Position=346; Antisense; AAACCTGTTACCTGGAGCACGACGA
>probe:Drosophila_2:1627972_at:537:131; Interrogation_Position=385; Antisense; ACCGCTTCCGGAATCTGGGTCAGAA
>probe:Drosophila_2:1627972_at:668:237; Interrogation_Position=408; Antisense; AATCTCTGCGGTGTCGATCGTCGGA
>probe:Drosophila_2:1627972_at:690:523; Interrogation_Position=439; Antisense; GGGACTTGAACGTGACCAATCTGGT
>probe:Drosophila_2:1627972_at:553:421; Interrogation_Position=492; Antisense; GAGCACAAACTCATCGACAGCAGTT
>probe:Drosophila_2:1627972_at:495:393; Interrogation_Position=507; Antisense; GACAGCAGTTACATTACCGATTTTA
>probe:Drosophila_2:1627972_at:399:701; Interrogation_Position=527; Antisense; TTTTAAGCTGACCAAAGACCTCGAA
>probe:Drosophila_2:1627972_at:74:259; Interrogation_Position=561; Antisense; CACTTTGTGGAAACCGTGCTGGACA
>probe:Drosophila_2:1627972_at:84:279; Interrogation_Position=644; Antisense; CTACATCTACAATACTGCCTGCAAC
>probe:Drosophila_2:1627972_at:576:359; Interrogation_Position=664; Antisense; GCAACTATGCCAGTGTCTATGCCAT
>probe:Drosophila_2:1627972_at:474:49; Interrogation_Position=682; Antisense; ATGCCATCGGAGTTCCTGTTTACAA
>probe:Drosophila_2:1627972_at:663:373; Interrogation_Position=739; Antisense; GAAGTAATCCAGAGTATCCCGCACT

Paste this into a BLAST search page for me
GAACTACATTGCCTCTGGATCTTTGTACCTGGCCACGTTGAACCTGAAAAAAACCTGTTACCTGGAGCACGACGAACCGCTTCCGGAATCTGGGTCAGAAAATCTCTGCGGTGTCGATCGTCGGAGGGACTTGAACGTGACCAATCTGGTGAGCACAAACTCATCGACAGCAGTTGACAGCAGTTACATTACCGATTTTATTTTAAGCTGACCAAAGACCTCGAACACTTTGTGGAAACCGTGCTGGACACTACATCTACAATACTGCCTGCAACGCAACTATGCCAGTGTCTATGCCATATGCCATCGGAGTTCCTGTTTACAAGAAGTAATCCAGAGTATCCCGCACT

Full Affymetrix probeset data:

Annotations for 1627972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720