FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627974_at:

>probe:Drosophila_2:1627974_at:655:339; Interrogation_Position=1029; Antisense; GCTACCCTAAGCTATGACACACTGA
>probe:Drosophila_2:1627974_at:182:613; Interrogation_Position=1043; Antisense; TGACACACTGATGACTTTGCCCTAT
>probe:Drosophila_2:1627974_at:512:573; Interrogation_Position=1106; Antisense; GGCTGCTGCTTTCGTCAACAGAGAG
>probe:Drosophila_2:1627974_at:15:427; Interrogation_Position=1126; Antisense; GAGAGTGCACCAGTTCGGCATCCGA
>probe:Drosophila_2:1627974_at:317:435; Interrogation_Position=1149; Antisense; GAGGGATTCTCACTGCAACCGCATG
>probe:Drosophila_2:1627974_at:19:697; Interrogation_Position=1178; Antisense; TTTCATAGTGCCACCAGGGATGCCA
>probe:Drosophila_2:1627974_at:708:625; Interrogation_Position=1198; Antisense; TGCCAGCATACATCTCAATACTCGG
>probe:Drosophila_2:1627974_at:577:621; Interrogation_Position=1257; Antisense; TGCGTCTTTGATCCCGAGAGATTCG
>probe:Drosophila_2:1627974_at:433:463; Interrogation_Position=1276; Antisense; GATTCGGTCCGGAGCGATCTAGGCA
>probe:Drosophila_2:1627974_at:450:55; Interrogation_Position=1311; Antisense; ATGACCTACATACCCTTTGGAGCAG
>probe:Drosophila_2:1627974_at:43:589; Interrogation_Position=1328; Antisense; TGGAGCAGGTCCACATGGCTGTATT
>probe:Drosophila_2:1627974_at:647:315; Interrogation_Position=1360; Antisense; GCCTGGGCGTACTCCAATTGAAACT
>probe:Drosophila_2:1627974_at:361:125; Interrogation_Position=935; Antisense; AGCCCTGATGGGATTCACTCTCTAT
>probe:Drosophila_2:1627974_at:625:729; Interrogation_Position=963; Antisense; TTGGCCAAGGCTCCGGATATTCAAG

Paste this into a BLAST search page for me
GCTACCCTAAGCTATGACACACTGATGACACACTGATGACTTTGCCCTATGGCTGCTGCTTTCGTCAACAGAGAGGAGAGTGCACCAGTTCGGCATCCGAGAGGGATTCTCACTGCAACCGCATGTTTCATAGTGCCACCAGGGATGCCATGCCAGCATACATCTCAATACTCGGTGCGTCTTTGATCCCGAGAGATTCGGATTCGGTCCGGAGCGATCTAGGCAATGACCTACATACCCTTTGGAGCAGTGGAGCAGGTCCACATGGCTGTATTGCCTGGGCGTACTCCAATTGAAACTAGCCCTGATGGGATTCACTCTCTATTTGGCCAAGGCTCCGGATATTCAAG

Full Affymetrix probeset data:

Annotations for 1627974_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720