FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627975_at:

>probe:Drosophila_2:1627975_at:338:163; Interrogation_Position=147; Antisense; AAATTATGCGAACCTCCTGGGACGA
>probe:Drosophila_2:1627975_at:101:23; Interrogation_Position=209; Antisense; ATATACAATCGCATGGCTCCTAGCT
>probe:Drosophila_2:1627975_at:296:573; Interrogation_Position=223; Antisense; GGCTCCTAGCTTAAGACCAGATGAA
>probe:Drosophila_2:1627975_at:200:35; Interrogation_Position=290; Antisense; ATCATGGTCGATGGAGTACCCAGTC
>probe:Drosophila_2:1627975_at:488:487; Interrogation_Position=305; Antisense; GTACCCAGTCAAGGTGGTGCTAGAA
>probe:Drosophila_2:1627975_at:38:711; Interrogation_Position=336; Antisense; TTAAGAAGATTCTGTCTCCGGCGGC
>probe:Drosophila_2:1627975_at:337:629; Interrogation_Position=352; Antisense; TCCGGCGGCAAAGAGCGTGGCAACT
>probe:Drosophila_2:1627975_at:436:519; Interrogation_Position=368; Antisense; GTGGCAACTGGATTCTTTACCGAAC
>probe:Drosophila_2:1627975_at:163:673; Interrogation_Position=385; Antisense; TACCGAACTCGGTGCAAGTCTTGCA
>probe:Drosophila_2:1627975_at:282:333; Interrogation_Position=423; Antisense; GCTGGTTTCCAGCTAACACAGAACG
>probe:Drosophila_2:1627975_at:8:199; Interrogation_Position=52; Antisense; AACGTCTTTGATCTGTTTCGCACTG
>probe:Drosophila_2:1627975_at:428:479; Interrogation_Position=66; Antisense; GTTTCGCACTGCTACTGATTGGAAC
>probe:Drosophila_2:1627975_at:650:603; Interrogation_Position=81; Antisense; TGATTGGAACTCTATGCTCGGCCTA
>probe:Drosophila_2:1627975_at:175:53; Interrogation_Position=94; Antisense; ATGCTCGGCCTATTCCAATCAAGAA

Paste this into a BLAST search page for me
AAATTATGCGAACCTCCTGGGACGAATATACAATCGCATGGCTCCTAGCTGGCTCCTAGCTTAAGACCAGATGAAATCATGGTCGATGGAGTACCCAGTCGTACCCAGTCAAGGTGGTGCTAGAATTAAGAAGATTCTGTCTCCGGCGGCTCCGGCGGCAAAGAGCGTGGCAACTGTGGCAACTGGATTCTTTACCGAACTACCGAACTCGGTGCAAGTCTTGCAGCTGGTTTCCAGCTAACACAGAACGAACGTCTTTGATCTGTTTCGCACTGGTTTCGCACTGCTACTGATTGGAACTGATTGGAACTCTATGCTCGGCCTAATGCTCGGCCTATTCCAATCAAGAA

Full Affymetrix probeset data:

Annotations for 1627975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720