FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627977_at:

>probe:Drosophila_2:1627977_at:479:687; Interrogation_Position=2128; Antisense; TATTATCAACCACTTTGTCCGCAAG
>probe:Drosophila_2:1627977_at:376:597; Interrogation_Position=2143; Antisense; TGTCCGCAAGCGAGATGAGCCCGGT
>probe:Drosophila_2:1627977_at:435:499; Interrogation_Position=2166; Antisense; GTCTCCGGCAATTGGTTGACCAGTT
>probe:Drosophila_2:1627977_at:372:305; Interrogation_Position=2185; Antisense; CCAGTTGAACGTTGACCAGCGGGTT
>probe:Drosophila_2:1627977_at:266:113; Interrogation_Position=2220; Antisense; AGCACGTCAAGGCATGGACCACCAA
>probe:Drosophila_2:1627977_at:641:573; Interrogation_Position=2260; Antisense; GGCGGGCAACATGATCCTCAAGTAC
>probe:Drosophila_2:1627977_at:309:549; Interrogation_Position=2291; Antisense; GGAGATGCTCTTCTGGATCCCAAGG
>probe:Drosophila_2:1627977_at:175:45; Interrogation_Position=2307; Antisense; ATCCCAAGGCGAGGTTCTACTACAA
>probe:Drosophila_2:1627977_at:729:63; Interrogation_Position=2339; Antisense; ATGGTCGAGGTACTCACTCCGTACG
>probe:Drosophila_2:1627977_at:351:145; Interrogation_Position=2354; Antisense; ACTCCGTACGTCCAGAGACACTTTA
>probe:Drosophila_2:1627977_at:715:419; Interrogation_Position=2368; Antisense; GAGACACTTTAAGCGGGTCACCGAG
>probe:Drosophila_2:1627977_at:554:543; Interrogation_Position=2401; Antisense; GGATCTGGCTTTCCTAGAGTTCATT
>probe:Drosophila_2:1627977_at:26:85; Interrogation_Position=2430; Antisense; AGTGCATGTAGGCTTTAGCTTCGGA
>probe:Drosophila_2:1627977_at:461:275; Interrogation_Position=2448; Antisense; CTTCGGAGCCGTTTCATTCATGATT

Paste this into a BLAST search page for me
TATTATCAACCACTTTGTCCGCAAGTGTCCGCAAGCGAGATGAGCCCGGTGTCTCCGGCAATTGGTTGACCAGTTCCAGTTGAACGTTGACCAGCGGGTTAGCACGTCAAGGCATGGACCACCAAGGCGGGCAACATGATCCTCAAGTACGGAGATGCTCTTCTGGATCCCAAGGATCCCAAGGCGAGGTTCTACTACAAATGGTCGAGGTACTCACTCCGTACGACTCCGTACGTCCAGAGACACTTTAGAGACACTTTAAGCGGGTCACCGAGGGATCTGGCTTTCCTAGAGTTCATTAGTGCATGTAGGCTTTAGCTTCGGACTTCGGAGCCGTTTCATTCATGATT

Full Affymetrix probeset data:

Annotations for 1627977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720