FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627979_at:

>probe:Drosophila_2:1627979_at:23:491; Interrogation_Position=449; Antisense; GTGACAACGTTAACTTTGGCCTTCG
>probe:Drosophila_2:1627979_at:700:523; Interrogation_Position=525; Antisense; GGGCACGCTGGTTAAGTTCCACAAT
>probe:Drosophila_2:1627979_at:204:241; Interrogation_Position=550; Antisense; AATAACGCAGGTCGATTGGCCATTC
>probe:Drosophila_2:1627979_at:491:85; Interrogation_Position=593; Antisense; AGTGCAAGTGTCACGGGCTTTCCGG
>probe:Drosophila_2:1627979_at:436:617; Interrogation_Position=622; Antisense; TGCACGGTGAAGACCTGCTGGCTGA
>probe:Drosophila_2:1627979_at:27:213; Interrogation_Position=646; Antisense; AAGATGCCTCCGTTCCGAGAAGTGG
>probe:Drosophila_2:1627979_at:526:555; Interrogation_Position=673; Antisense; GGACGACTGCGAGACCGGTATGACA
>probe:Drosophila_2:1627979_at:62:383; Interrogation_Position=729; Antisense; GAACAGCTTCATGCCGGAGAGTCCG
>probe:Drosophila_2:1627979_at:401:487; Interrogation_Position=774; Antisense; GTACCAGTTGGTCTTCGCAGACGAT
>probe:Drosophila_2:1627979_at:171:433; Interrogation_Position=856; Antisense; GAGTGCAATGTGACCAGTTCCGGAT
>probe:Drosophila_2:1627979_at:519:51; Interrogation_Position=888; Antisense; ATGCGATCGCTTGTGCTGCAATCGA
>probe:Drosophila_2:1627979_at:424:43; Interrogation_Position=908; Antisense; ATCGAGGACACACCCGCAGGATTGT
>probe:Drosophila_2:1627979_at:666:219; Interrogation_Position=952; Antisense; AAGTGCGTCTTTAAGTGGTGCTGCG
>probe:Drosophila_2:1627979_at:537:533; Interrogation_Position=978; Antisense; GGTGACCTGCGAAAAGTGCCTGGAA

Paste this into a BLAST search page for me
GTGACAACGTTAACTTTGGCCTTCGGGGCACGCTGGTTAAGTTCCACAATAATAACGCAGGTCGATTGGCCATTCAGTGCAAGTGTCACGGGCTTTCCGGTGCACGGTGAAGACCTGCTGGCTGAAAGATGCCTCCGTTCCGAGAAGTGGGGACGACTGCGAGACCGGTATGACAGAACAGCTTCATGCCGGAGAGTCCGGTACCAGTTGGTCTTCGCAGACGATGAGTGCAATGTGACCAGTTCCGGATATGCGATCGCTTGTGCTGCAATCGAATCGAGGACACACCCGCAGGATTGTAAGTGCGTCTTTAAGTGGTGCTGCGGGTGACCTGCGAAAAGTGCCTGGAA

Full Affymetrix probeset data:

Annotations for 1627979_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720