FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627981_at:

>probe:Drosophila_2:1627981_at:356:267; Interrogation_Position=1003; Antisense; CATGGTGGCAAGTGGTCTGTACAAA
>probe:Drosophila_2:1627981_at:299:165; Interrogation_Position=1026; Antisense; AAATCTGGCCCTCTATTTGGAAGGA
>probe:Drosophila_2:1627981_at:126:699; Interrogation_Position=1067; Antisense; TTACGGATCGTTTGTTTGGAGCCAT
>probe:Drosophila_2:1627981_at:78:681; Interrogation_Position=1091; Antisense; TATCCTGGCTTATAGTACACTCCTT
>probe:Drosophila_2:1627981_at:82:665; Interrogation_Position=1106; Antisense; TACACTCCTTAAGAGCTGTGGCTCC
>probe:Drosophila_2:1627981_at:349:433; Interrogation_Position=1159; Antisense; GAGTGTTATGGCTACGACATCATCA
>probe:Drosophila_2:1627981_at:656:395; Interrogation_Position=1186; Antisense; GACAATGCCTTGAAACCTTGGCTAG
>probe:Drosophila_2:1627981_at:424:611; Interrogation_Position=1281; Antisense; TGACAACATACTGTCCGTGGTCCTA
>probe:Drosophila_2:1627981_at:129:433; Interrogation_Position=1316; Antisense; GAGTGCCCGATGTGCGTTGGAATAA
>probe:Drosophila_2:1627981_at:600:363; Interrogation_Position=1335; Antisense; GAATAAGGTTCCCAGTGCCGATGCT
>probe:Drosophila_2:1627981_at:347:53; Interrogation_Position=1355; Antisense; ATGCTTTGGGCAACTTTGAGCTGCT
>probe:Drosophila_2:1627981_at:617:427; Interrogation_Position=1390; Antisense; GAGTTGGCCGCCCAGGATGAACAAC
>probe:Drosophila_2:1627981_at:582:541; Interrogation_Position=886; Antisense; GGATTCTGCCGTTTTTGTACTGTAA
>probe:Drosophila_2:1627981_at:17:577; Interrogation_Position=984; Antisense; TGGCGAATACAATACCCTACATGGT

Paste this into a BLAST search page for me
CATGGTGGCAAGTGGTCTGTACAAAAAATCTGGCCCTCTATTTGGAAGGATTACGGATCGTTTGTTTGGAGCCATTATCCTGGCTTATAGTACACTCCTTTACACTCCTTAAGAGCTGTGGCTCCGAGTGTTATGGCTACGACATCATCAGACAATGCCTTGAAACCTTGGCTAGTGACAACATACTGTCCGTGGTCCTAGAGTGCCCGATGTGCGTTGGAATAAGAATAAGGTTCCCAGTGCCGATGCTATGCTTTGGGCAACTTTGAGCTGCTGAGTTGGCCGCCCAGGATGAACAACGGATTCTGCCGTTTTTGTACTGTAATGGCGAATACAATACCCTACATGGT

Full Affymetrix probeset data:

Annotations for 1627981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720