FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627982_at:

>probe:Drosophila_2:1627982_at:171:9; Interrogation_Position=2432; Antisense; ATTGCGCTGGTTACAGACAATGCAT
>probe:Drosophila_2:1627982_at:696:247; Interrogation_Position=2449; Antisense; CAATGCATTCGAGGTCTGGTTCAAA
>probe:Drosophila_2:1627982_at:580:253; Interrogation_Position=2470; Antisense; CAAAATCTGAATTGTCCCCTTGGAC
>probe:Drosophila_2:1627982_at:591:501; Interrogation_Position=2483; Antisense; GTCCCCTTGGACAATACTTTAATGT
>probe:Drosophila_2:1627982_at:176:55; Interrogation_Position=2591; Antisense; ATGACACTGGCCCACCGATGACTAA
>probe:Drosophila_2:1627982_at:307:611; Interrogation_Position=2609; Antisense; TGACTAAGCCCGATGAGTCCTGCAT
>probe:Drosophila_2:1627982_at:409:529; Interrogation_Position=2648; Antisense; GGGTTTGTGTTGATCCACTTGCAAA
>probe:Drosophila_2:1627982_at:189:9; Interrogation_Position=2708; Antisense; ATTGCGCAGGATACCTCAAATGTCA
>probe:Drosophila_2:1627982_at:615:561; Interrogation_Position=2751; Antisense; GGAACTTTGCCCCAATGGCTTCTAC
>probe:Drosophila_2:1627982_at:722:227; Interrogation_Position=2764; Antisense; AATGGCTTCTACTACGATTTTCTAA
>probe:Drosophila_2:1627982_at:270:421; Interrogation_Position=2852; Antisense; GAGCACTTGAAGAGGATCCCCATGA
>probe:Drosophila_2:1627982_at:301:449; Interrogation_Position=2866; Antisense; GATCCCCATGACTGTGCTGGTTACA
>probe:Drosophila_2:1627982_at:390:273; Interrogation_Position=2939; Antisense; CATATTTTAATGTGCCCCTCAGAGA
>probe:Drosophila_2:1627982_at:234:507; Interrogation_Position=2950; Antisense; GTGCCCCTCAGAGATTGTCTTATTG

Paste this into a BLAST search page for me
ATTGCGCTGGTTACAGACAATGCATCAATGCATTCGAGGTCTGGTTCAAACAAAATCTGAATTGTCCCCTTGGACGTCCCCTTGGACAATACTTTAATGTATGACACTGGCCCACCGATGACTAATGACTAAGCCCGATGAGTCCTGCATGGGTTTGTGTTGATCCACTTGCAAAATTGCGCAGGATACCTCAAATGTCAGGAACTTTGCCCCAATGGCTTCTACAATGGCTTCTACTACGATTTTCTAAGAGCACTTGAAGAGGATCCCCATGAGATCCCCATGACTGTGCTGGTTACACATATTTTAATGTGCCCCTCAGAGAGTGCCCCTCAGAGATTGTCTTATTG

Full Affymetrix probeset data:

Annotations for 1627982_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720