FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627983_at:

>probe:Drosophila_2:1627983_at:470:721; Interrogation_Position=1007; Antisense; TTGCGTCGGAATATACAGTGCTTGT
>probe:Drosophila_2:1627983_at:232:681; Interrogation_Position=1105; Antisense; TATGTCATTCTGTTTCCTAGGCTAG
>probe:Drosophila_2:1627983_at:109:349; Interrogation_Position=606; Antisense; GCAGGTTCAGCAGTTCTGCCAGGAC
>probe:Drosophila_2:1627983_at:362:533; Interrogation_Position=666; Antisense; GGTGATCACCAAGCTCAGCAACAGC
>probe:Drosophila_2:1627983_at:12:187; Interrogation_Position=712; Antisense; AACAATGTCGCCAAGCTCGGTCAGG
>probe:Drosophila_2:1627983_at:162:507; Interrogation_Position=736; Antisense; GTGCGCATCCAGGTGTTGCGTTTAA
>probe:Drosophila_2:1627983_at:729:663; Interrogation_Position=758; Antisense; TAAAGAGCGGTGTCTTCCGTGAGGT
>probe:Drosophila_2:1627983_at:23:381; Interrogation_Position=802; Antisense; GAACGCGTTCTGGACGAAGGAAACT
>probe:Drosophila_2:1627983_at:204:391; Interrogation_Position=821; Antisense; GAAACTATGCCTGCGAGGAGACACG
>probe:Drosophila_2:1627983_at:135:549; Interrogation_Position=849; Antisense; GGAGGTGCTCTACAAGGTCAACGAT
>probe:Drosophila_2:1627983_at:617:197; Interrogation_Position=868; Antisense; AACGATCGCAACGTCAAGGTCTTTG
>probe:Drosophila_2:1627983_at:569:221; Interrogation_Position=883; Antisense; AAGGTCTTTGCACCCGGCGAAATTG
>probe:Drosophila_2:1627983_at:455:481; Interrogation_Position=972; Antisense; GTATATTCCAAACATAGCCAGTCAA
>probe:Drosophila_2:1627983_at:142:493; Interrogation_Position=992; Antisense; GTCAAAGGTTTCATATTGCGTCGGA

Paste this into a BLAST search page for me
TTGCGTCGGAATATACAGTGCTTGTTATGTCATTCTGTTTCCTAGGCTAGGCAGGTTCAGCAGTTCTGCCAGGACGGTGATCACCAAGCTCAGCAACAGCAACAATGTCGCCAAGCTCGGTCAGGGTGCGCATCCAGGTGTTGCGTTTAATAAAGAGCGGTGTCTTCCGTGAGGTGAACGCGTTCTGGACGAAGGAAACTGAAACTATGCCTGCGAGGAGACACGGGAGGTGCTCTACAAGGTCAACGATAACGATCGCAACGTCAAGGTCTTTGAAGGTCTTTGCACCCGGCGAAATTGGTATATTCCAAACATAGCCAGTCAAGTCAAAGGTTTCATATTGCGTCGGA

Full Affymetrix probeset data:

Annotations for 1627983_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720