FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627984_at:

>probe:Drosophila_2:1627984_at:14:113; Interrogation_Position=5896; Antisense; AGCACACTGTCCACGCGGGAATTGT
>probe:Drosophila_2:1627984_at:524:353; Interrogation_Position=5925; Antisense; GCAGCGATCTATTTCAGTGCCAGCT
>probe:Drosophila_2:1627984_at:176:713; Interrogation_Position=5937; Antisense; TTCAGTGCCAGCTGGTGGTACAGAT
>probe:Drosophila_2:1627984_at:521:181; Interrogation_Position=5971; Antisense; AACAAGGGACGTCACAGCTTCCTAT
>probe:Drosophila_2:1627984_at:677:249; Interrogation_Position=6000; Antisense; CAAGTCCCGAGAGATCCTGGCCAAG
>probe:Drosophila_2:1627984_at:477:377; Interrogation_Position=6066; Antisense; GAAGCAAACCGAAGCTCCTGTCGAG
>probe:Drosophila_2:1627984_at:475:9; Interrogation_Position=6146; Antisense; ATTCCGCGGTGTCGAGCATGCTGCA
>probe:Drosophila_2:1627984_at:583:243; Interrogation_Position=6178; Antisense; AATTTGCGCAACAGTTTGCCCTCCA
>probe:Drosophila_2:1627984_at:54:321; Interrogation_Position=6218; Antisense; GCCCCAATACGCTGCATCTGAAGAA
>probe:Drosophila_2:1627984_at:183:203; Interrogation_Position=6285; Antisense; AACCACCACCAACGGAATGTCGAAT
>probe:Drosophila_2:1627984_at:205:1; Interrogation_Position=6317; Antisense; ACAAGTCGGCCCAGGCGGTTAAGCA
>probe:Drosophila_2:1627984_at:448:107; Interrogation_Position=6341; Antisense; AGAAACTGGACCTGCTCATCGATGC
>probe:Drosophila_2:1627984_at:96:417; Interrogation_Position=6412; Antisense; GAGCGCTCCAGCACCTTTTGCAAAG
>probe:Drosophila_2:1627984_at:469:693; Interrogation_Position=6428; Antisense; TTTGCAAAGACAGCGCCGATCTGGA

Paste this into a BLAST search page for me
AGCACACTGTCCACGCGGGAATTGTGCAGCGATCTATTTCAGTGCCAGCTTTCAGTGCCAGCTGGTGGTACAGATAACAAGGGACGTCACAGCTTCCTATCAAGTCCCGAGAGATCCTGGCCAAGGAAGCAAACCGAAGCTCCTGTCGAGATTCCGCGGTGTCGAGCATGCTGCAAATTTGCGCAACAGTTTGCCCTCCAGCCCCAATACGCTGCATCTGAAGAAAACCACCACCAACGGAATGTCGAATACAAGTCGGCCCAGGCGGTTAAGCAAGAAACTGGACCTGCTCATCGATGCGAGCGCTCCAGCACCTTTTGCAAAGTTTGCAAAGACAGCGCCGATCTGGA

Full Affymetrix probeset data:

Annotations for 1627984_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720