Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627985_a_at:

>probe:Drosophila_2:1627985_a_at:408:587; Interrogation_Position=143; Antisense; TGGACCTGGAGCCTACATGCTACCC
>probe:Drosophila_2:1627985_a_at:322:53; Interrogation_Position=159; Antisense; ATGCTACCCAGCAGTTTTGGACAAA
>probe:Drosophila_2:1627985_a_at:423:237; Interrogation_Position=180; Antisense; CAAAAAGGACCTCAGTTCTCCTTCG
>probe:Drosophila_2:1627985_a_at:365:385; Interrogation_Position=20; Antisense; GAACACATACCTTTTTTGCTTCCCA
>probe:Drosophila_2:1627985_a_at:24:277; Interrogation_Position=200; Antisense; CTTCGGCCGCAGAATTGACCGCAAA
>probe:Drosophila_2:1627985_a_at:317:441; Interrogation_Position=228; Antisense; GATGAAAAACCTGGTCCGGGTCCTG
>probe:Drosophila_2:1627985_a_at:630:627; Interrogation_Position=242; Antisense; TCCGGGTCCTGCTGCTTATAAGGTG
>probe:Drosophila_2:1627985_a_at:601:219; Interrogation_Position=271; Antisense; AAGTGACACGCTACGGAAACGCGGA
>probe:Drosophila_2:1627985_a_at:433:81; Interrogation_Position=295; Antisense; AGGGTCCACAGTTTTCCATGTATGT
>probe:Drosophila_2:1627985_a_at:160:659; Interrogation_Position=320; Antisense; TAGGAACTCCAAGATGAAACCCCTT
>probe:Drosophila_2:1627985_a_at:634:301; Interrogation_Position=340; Antisense; CCCTTCCCATTCGATTGTCTTGAAG
>probe:Drosophila_2:1627985_a_at:206:375; Interrogation_Position=361; Antisense; GAAGATTCGATCCTGATTCCGTATT
>probe:Drosophila_2:1627985_a_at:481:443; Interrogation_Position=419; Antisense; GATGTACATACATAGCGGCGAAATA
>probe:Drosophila_2:1627985_a_at:654:481; Interrogation_Position=85; Antisense; GTATTGTTGAAATTAGCCACAGCGA

Paste this into a BLAST search page for me
TGGACCTGGAGCCTACATGCTACCCATGCTACCCAGCAGTTTTGGACAAACAAAAAGGACCTCAGTTCTCCTTCGGAACACATACCTTTTTTGCTTCCCACTTCGGCCGCAGAATTGACCGCAAAGATGAAAAACCTGGTCCGGGTCCTGTCCGGGTCCTGCTGCTTATAAGGTGAAGTGACACGCTACGGAAACGCGGAAGGGTCCACAGTTTTCCATGTATGTTAGGAACTCCAAGATGAAACCCCTTCCCTTCCCATTCGATTGTCTTGAAGGAAGATTCGATCCTGATTCCGTATTGATGTACATACATAGCGGCGAAATAGTATTGTTGAAATTAGCCACAGCGA

Full Affymetrix probeset data:

Annotations for 1627985_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime