Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627986_s_at:

>probe:Drosophila_2:1627986_s_at:266:497; Interrogation_Position=108; Antisense; GTCTATGTCGTCTCCAAGGCGGAGT
>probe:Drosophila_2:1627986_s_at:565:633; Interrogation_Position=140; Antisense; TCGCGGCGCCAAATGGACCGTAGGC
>probe:Drosophila_2:1627986_s_at:392:169; Interrogation_Position=150; Antisense; AAATGGACCGTAGGCCTGGGCAACT
>probe:Drosophila_2:1627986_s_at:88:681; Interrogation_Position=160; Antisense; TAGGCCTGGGCAACTACCTCAGCTA
>probe:Drosophila_2:1627986_s_at:57:85; Interrogation_Position=232; Antisense; AGTGCAACGCCGTGCTGCAGAGCGT
>probe:Drosophila_2:1627986_s_at:156:619; Interrogation_Position=247; Antisense; TGCAGAGCGTCCAGAACTACCACAT
>probe:Drosophila_2:1627986_s_at:5:523; Interrogation_Position=343; Antisense; GTGGCTGGAACAACATGGGCGCCCA
>probe:Drosophila_2:1627986_s_at:348:83; Interrogation_Position=376; Antisense; AGTGGAACCCCTACAGCATCGGCAT
>probe:Drosophila_2:1627986_s_at:8:565; Interrogation_Position=411; Antisense; GGCAACTACAACTGGGACACCCTGG
>probe:Drosophila_2:1627986_s_at:127:527; Interrogation_Position=424; Antisense; GGGACACCCTGGAGCCGAACATGAT
>probe:Drosophila_2:1627986_s_at:135:281; Interrogation_Position=500; Antisense; CTCCGGCTACATCCTGTACGGTCAT
>probe:Drosophila_2:1627986_s_at:672:669; Interrogation_Position=516; Antisense; TACGGTCATCGCCAGGTCAGCGCCA
>probe:Drosophila_2:1627986_s_at:236:425; Interrogation_Position=570; Antisense; GAGATCCGCGGCTGGTCCCACTGGT
>probe:Drosophila_2:1627986_s_at:409:69; Interrogation_Position=96; Antisense; ATGGCCCAGGGCGTCTATGTCGTCT

Paste this into a BLAST search page for me
GTCTATGTCGTCTCCAAGGCGGAGTTCGCGGCGCCAAATGGACCGTAGGCAAATGGACCGTAGGCCTGGGCAACTTAGGCCTGGGCAACTACCTCAGCTAAGTGCAACGCCGTGCTGCAGAGCGTTGCAGAGCGTCCAGAACTACCACATGTGGCTGGAACAACATGGGCGCCCAAGTGGAACCCCTACAGCATCGGCATGGCAACTACAACTGGGACACCCTGGGGGACACCCTGGAGCCGAACATGATCTCCGGCTACATCCTGTACGGTCATTACGGTCATCGCCAGGTCAGCGCCAGAGATCCGCGGCTGGTCCCACTGGTATGGCCCAGGGCGTCTATGTCGTCT

Full Affymetrix probeset data:

Annotations for 1627986_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime