FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627988_at:

>probe:Drosophila_2:1627988_at:278:599; Interrogation_Position=1011; Antisense; TGTCGCGTCTGCTCAAGTCTGAGGA
>probe:Drosophila_2:1627988_at:242:119; Interrogation_Position=1116; Antisense; AGCTGATCAAGCTTAACCCCTATGC
>probe:Drosophila_2:1627988_at:109:209; Interrogation_Position=1214; Antisense; AAGCAGAACGTCGAGCTGGCCAAGT
>probe:Drosophila_2:1627988_at:370:311; Interrogation_Position=1232; Antisense; GCCAAGTCGCACTTCGCCAATGTGG
>probe:Drosophila_2:1627988_at:196:361; Interrogation_Position=1299; Antisense; GCAAGAAGAAGGTCGCCGCCAAGAA
>probe:Drosophila_2:1627988_at:121:301; Interrogation_Position=1353; Antisense; CCCCGAGTAGAGCTGACACACTTTT
>probe:Drosophila_2:1627988_at:569:85; Interrogation_Position=1428; Antisense; AGTGCGCGACAGTAATGCTCATTAA
>probe:Drosophila_2:1627988_at:560:661; Interrogation_Position=1450; Antisense; TAAACTCTTAGTCTTAGGCACATCA
>probe:Drosophila_2:1627988_at:702:537; Interrogation_Position=875; Antisense; GGTCATGTCGGTCGCTTTGTCATCT
>probe:Drosophila_2:1627988_at:575:691; Interrogation_Position=890; Antisense; TTTGTCATCTGGACCGAGTCGGCTT
>probe:Drosophila_2:1627988_at:85:383; Interrogation_Position=925; Antisense; GAACGATCTGTTCGGCACCTGGAAG
>probe:Drosophila_2:1627988_at:141:377; Interrogation_Position=946; Antisense; GAAGAAGCCGTCCACCTTGAAGAAG
>probe:Drosophila_2:1627988_at:583:375; Interrogation_Position=964; Antisense; GAAGAAGGGCTACAACCTGCCCCAG
>probe:Drosophila_2:1627988_at:245:215; Interrogation_Position=992; Antisense; AAGATGGCCAACACCGATCTGTCGC

Paste this into a BLAST search page for me
TGTCGCGTCTGCTCAAGTCTGAGGAAGCTGATCAAGCTTAACCCCTATGCAAGCAGAACGTCGAGCTGGCCAAGTGCCAAGTCGCACTTCGCCAATGTGGGCAAGAAGAAGGTCGCCGCCAAGAACCCCGAGTAGAGCTGACACACTTTTAGTGCGCGACAGTAATGCTCATTAATAAACTCTTAGTCTTAGGCACATCAGGTCATGTCGGTCGCTTTGTCATCTTTTGTCATCTGGACCGAGTCGGCTTGAACGATCTGTTCGGCACCTGGAAGGAAGAAGCCGTCCACCTTGAAGAAGGAAGAAGGGCTACAACCTGCCCCAGAAGATGGCCAACACCGATCTGTCGC

Full Affymetrix probeset data:

Annotations for 1627988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720