FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627990_at:

>probe:Drosophila_2:1627990_at:388:641; Interrogation_Position=14; Antisense; TCAGCCGTTTAGTCGAAAGCACACA
>probe:Drosophila_2:1627990_at:209:537; Interrogation_Position=163; Antisense; GGTACTAAAGCGCTTGCCAGTCTGC
>probe:Drosophila_2:1627990_at:426:641; Interrogation_Position=183; Antisense; TCTGCTGAGAGAAACAATCCCAACT
>probe:Drosophila_2:1627990_at:490:45; Interrogation_Position=199; Antisense; ATCCCAACTGTTCGCAATTTACTGA
>probe:Drosophila_2:1627990_at:572:721; Interrogation_Position=230; Antisense; TTGACTTCAATCCACCAACCGATAT
>probe:Drosophila_2:1627990_at:164:507; Interrogation_Position=308; Antisense; GTGCGCTTGACAAGACTCAGTGTCT
>probe:Drosophila_2:1627990_at:562:357; Interrogation_Position=32; Antisense; GCACACAGATAAGGCTTCCAATGAA
>probe:Drosophila_2:1627990_at:155:281; Interrogation_Position=323; Antisense; CTCAGTGTCTGATTGTGCCACTCAA
>probe:Drosophila_2:1627990_at:198:85; Interrogation_Position=354; Antisense; AGTGAGACTACTGAGGCCTTATGTA
>probe:Drosophila_2:1627990_at:426:439; Interrogation_Position=366; Antisense; GAGGCCTTATGTAAAATCGCTTGAG
>probe:Drosophila_2:1627990_at:528:43; Interrogation_Position=381; Antisense; ATCGCTTGAGACCAACAAATGCTTG
>probe:Drosophila_2:1627990_at:18:475; Interrogation_Position=67; Antisense; GTTACACTAGTGTTCAGCTTACTGG
>probe:Drosophila_2:1627990_at:569:115; Interrogation_Position=82; Antisense; AGCTTACTGGCTCTCGTATTTGTGG
>probe:Drosophila_2:1627990_at:253:19; Interrogation_Position=99; Antisense; ATTTGTGGCCCAAACGGAGGCGCAA

Paste this into a BLAST search page for me
TCAGCCGTTTAGTCGAAAGCACACAGGTACTAAAGCGCTTGCCAGTCTGCTCTGCTGAGAGAAACAATCCCAACTATCCCAACTGTTCGCAATTTACTGATTGACTTCAATCCACCAACCGATATGTGCGCTTGACAAGACTCAGTGTCTGCACACAGATAAGGCTTCCAATGAACTCAGTGTCTGATTGTGCCACTCAAAGTGAGACTACTGAGGCCTTATGTAGAGGCCTTATGTAAAATCGCTTGAGATCGCTTGAGACCAACAAATGCTTGGTTACACTAGTGTTCAGCTTACTGGAGCTTACTGGCTCTCGTATTTGTGGATTTGTGGCCCAAACGGAGGCGCAA

Full Affymetrix probeset data:

Annotations for 1627990_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720