Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627993_at:

>probe:Drosophila_2:1627993_at:125:421; Interrogation_Position=1080; Antisense; GAGCAGAAGATTGCCGTCTCGAGGA
>probe:Drosophila_2:1627993_at:373:529; Interrogation_Position=1111; Antisense; GGGAGATAAACTCCGCGCCTGATCT
>probe:Drosophila_2:1627993_at:330:531; Interrogation_Position=1168; Antisense; TGGCCAAGAACGACTTTCCCGAGGC
>probe:Drosophila_2:1627993_at:637:631; Interrogation_Position=1184; Antisense; TCCCGAGGCCTATGTGATATTCCAG
>probe:Drosophila_2:1627993_at:537:459; Interrogation_Position=1199; Antisense; GATATTCCAGAAAGCTCTGCACCTG
>probe:Drosophila_2:1627993_at:675:557; Interrogation_Position=1223; Antisense; GGACACCGGCAACACAATGATCCTG
>probe:Drosophila_2:1627993_at:92:189; Interrogation_Position=1251; Antisense; AACATGGGAGTGTGCCTTCTCTACG
>probe:Drosophila_2:1627993_at:461:29; Interrogation_Position=1296; Antisense; ATAAATCTGTACGAGCGCGCTATCA
>probe:Drosophila_2:1627993_at:274:341; Interrogation_Position=1314; Antisense; GCTATCAACCTGAATCCCCAGAAGT
>probe:Drosophila_2:1627993_at:267:373; Interrogation_Position=1334; Antisense; GAAGTCCCTCAACGAGAGTTTGCTG
>probe:Drosophila_2:1627993_at:2:431; Interrogation_Position=1349; Antisense; GAGTTTGCTGGTCAATCTCTCGACG
>probe:Drosophila_2:1627993_at:75:37; Interrogation_Position=1363; Antisense; ATCTCTCGACGCTGTATGAACTGGA
>probe:Drosophila_2:1627993_at:215:487; Interrogation_Position=1412; Antisense; GTACAACTTACTGCGCCTAATTAAC
>probe:Drosophila_2:1627993_at:643:241; Interrogation_Position=1547; Antisense; AATAGGTGAGCCCTTCTTTGAGTCC

Paste this into a BLAST search page for me
GAGCAGAAGATTGCCGTCTCGAGGAGGGAGATAAACTCCGCGCCTGATCTTGGCCAAGAACGACTTTCCCGAGGCTCCCGAGGCCTATGTGATATTCCAGGATATTCCAGAAAGCTCTGCACCTGGGACACCGGCAACACAATGATCCTGAACATGGGAGTGTGCCTTCTCTACGATAAATCTGTACGAGCGCGCTATCAGCTATCAACCTGAATCCCCAGAAGTGAAGTCCCTCAACGAGAGTTTGCTGGAGTTTGCTGGTCAATCTCTCGACGATCTCTCGACGCTGTATGAACTGGAGTACAACTTACTGCGCCTAATTAACAATAGGTGAGCCCTTCTTTGAGTCC

Full Affymetrix probeset data:

Annotations for 1627993_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime