Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627994_at:

>probe:Drosophila_2:1627994_at:309:243; Interrogation_Position=1050; Antisense; AATTTGTGGTCTTGCAATCTGCTCC
>probe:Drosophila_2:1627994_at:72:631; Interrogation_Position=1072; Antisense; TCCTTTTTCTTTTGCACCGAACATG
>probe:Drosophila_2:1627994_at:584:673; Interrogation_Position=1098; Antisense; TAGCTTTTACTTCGCCATTTTGGGT
>probe:Drosophila_2:1627994_at:602:13; Interrogation_Position=1134; Antisense; ATTAGCACACAGTTTGCTGCACTTA
>probe:Drosophila_2:1627994_at:365:615; Interrogation_Position=1151; Antisense; TGCACTTACTGTTACTTTTGGTTGT
>probe:Drosophila_2:1627994_at:233:453; Interrogation_Position=1182; Antisense; GATCTATGGCCAAAAACGCTTCCAG
>probe:Drosophila_2:1627994_at:684:703; Interrogation_Position=1256; Antisense; TTATACTTCGCTATACAGCTCCAAT
>probe:Drosophila_2:1627994_at:538:509; Interrogation_Position=1317; Antisense; GTGCATACGAGTTCACTTCTTCTTT
>probe:Drosophila_2:1627994_at:388:373; Interrogation_Position=1345; Antisense; GAAGTGTTCCTCGTACTAGGCATTA
>probe:Drosophila_2:1627994_at:132:273; Interrogation_Position=1365; Antisense; CATTATACTTGTCGTGTTGCCCTTT
>probe:Drosophila_2:1627994_at:248:321; Interrogation_Position=1383; Antisense; GCCCTTTTTGGCAATACCTGGTTAT
>probe:Drosophila_2:1627994_at:638:705; Interrogation_Position=1413; Antisense; TTACTACCTGAGACAGAGTCCTGGC
>probe:Drosophila_2:1627994_at:396:431; Interrogation_Position=1428; Antisense; GAGTCCTGGCACCTTTTTGGAGCGT
>probe:Drosophila_2:1627994_at:29:445; Interrogation_Position=1539; Antisense; GATGACCGACCATCTTTTCAATGGT

Paste this into a BLAST search page for me
AATTTGTGGTCTTGCAATCTGCTCCTCCTTTTTCTTTTGCACCGAACATGTAGCTTTTACTTCGCCATTTTGGGTATTAGCACACAGTTTGCTGCACTTATGCACTTACTGTTACTTTTGGTTGTGATCTATGGCCAAAAACGCTTCCAGTTATACTTCGCTATACAGCTCCAATGTGCATACGAGTTCACTTCTTCTTTGAAGTGTTCCTCGTACTAGGCATTACATTATACTTGTCGTGTTGCCCTTTGCCCTTTTTGGCAATACCTGGTTATTTACTACCTGAGACAGAGTCCTGGCGAGTCCTGGCACCTTTTTGGAGCGTGATGACCGACCATCTTTTCAATGGT

Full Affymetrix probeset data:

Annotations for 1627994_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime