FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627995_at:

>probe:Drosophila_2:1627995_at:512:79; Interrogation_Position=1022; Antisense; AGGTGGATTTGCTAGACCCCAACAC
>probe:Drosophila_2:1627995_at:605:155; Interrogation_Position=1043; Antisense; ACACAGAGGAGCATCCAGTGCCTTG
>probe:Drosophila_2:1627995_at:167:219; Interrogation_Position=1084; Antisense; AAGTGCATTCTGACGGAAGCTCATC
>probe:Drosophila_2:1627995_at:676:473; Interrogation_Position=1132; Antisense; GTTACATGCCATCTCGGAATCCGAA
>probe:Drosophila_2:1627995_at:427:633; Interrogation_Position=667; Antisense; TCCCGACCGGAGATTACACAGCTGA
>probe:Drosophila_2:1627995_at:453:365; Interrogation_Position=690; Antisense; GAATCCGCAAGATCTTCTGCACGAG
>probe:Drosophila_2:1627995_at:480:83; Interrogation_Position=713; Antisense; AGGGCGTCGTCTTTCACTGGATGAA
>probe:Drosophila_2:1627995_at:506:121; Interrogation_Position=757; Antisense; AGCGATTTGGACAGCATTCAGTTCA
>probe:Drosophila_2:1627995_at:341:127; Interrogation_Position=815; Antisense; ACCAGGGCTTCTGCATTTGGTTCGA
>probe:Drosophila_2:1627995_at:484:729; Interrogation_Position=831; Antisense; TTGGTTCGATGTACAGTTTCCTGGC
>probe:Drosophila_2:1627995_at:565:461; Interrogation_Position=859; Antisense; GATTTTGTTCTAAGCACATCGCCGC
>probe:Drosophila_2:1627995_at:387:83; Interrogation_Position=908; Antisense; AGTGTGTAGTCGTCCTGCCCGAGGA
>probe:Drosophila_2:1627995_at:14:549; Interrogation_Position=948; Antisense; GGAGGAGAAGTCACCCATTGCATTT
>probe:Drosophila_2:1627995_at:319:267; Interrogation_Position=990; Antisense; CAGTGCTGCCGATATGCGTAAATAC

Paste this into a BLAST search page for me
AGGTGGATTTGCTAGACCCCAACACACACAGAGGAGCATCCAGTGCCTTGAAGTGCATTCTGACGGAAGCTCATCGTTACATGCCATCTCGGAATCCGAATCCCGACCGGAGATTACACAGCTGAGAATCCGCAAGATCTTCTGCACGAGAGGGCGTCGTCTTTCACTGGATGAAAGCGATTTGGACAGCATTCAGTTCAACCAGGGCTTCTGCATTTGGTTCGATTGGTTCGATGTACAGTTTCCTGGCGATTTTGTTCTAAGCACATCGCCGCAGTGTGTAGTCGTCCTGCCCGAGGAGGAGGAGAAGTCACCCATTGCATTTCAGTGCTGCCGATATGCGTAAATAC

Full Affymetrix probeset data:

Annotations for 1627995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720