FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627997_at:

>probe:Drosophila_2:1627997_at:199:385; Interrogation_Position=1032; Antisense; GAACTCGTCGAATCGGACACCCGTA
>probe:Drosophila_2:1627997_at:643:291; Interrogation_Position=1053; Antisense; CGTACTTTGGTGCAGGCGAATCTCT
>probe:Drosophila_2:1627997_at:329:325; Interrogation_Position=1068; Antisense; GCGAATCTCTGCAACGTGGTGGTCA
>probe:Drosophila_2:1627997_at:595:533; Interrogation_Position=1085; Antisense; GGTGGTCATCCAACATTTGAACGAG
>probe:Drosophila_2:1627997_at:175:341; Interrogation_Position=1137; Antisense; GCTTCAGAACCCATCGTGCAATAAA
>probe:Drosophila_2:1627997_at:397:617; Interrogation_Position=632; Antisense; TGCACTGCCCGAAAACGAGCGATTT
>probe:Drosophila_2:1627997_at:344:683; Interrogation_Position=747; Antisense; TATCGTCACTTGTCCCGGAAACAGT
>probe:Drosophila_2:1627997_at:124:63; Interrogation_Position=774; Antisense; ATGGGACCAGGTCGACCGCTGAACA
>probe:Drosophila_2:1627997_at:337:265; Interrogation_Position=810; Antisense; CAGATACTCGTCGTAGGCCCAATGC
>probe:Drosophila_2:1627997_at:379:199; Interrogation_Position=847; Antisense; AAGGCCTTCAGCTCAACGAACGGGC
>probe:Drosophila_2:1627997_at:136:261; Interrogation_Position=875; Antisense; CACGACCACCGTGCAGTTGAGGATG
>probe:Drosophila_2:1627997_at:438:429; Interrogation_Position=908; Antisense; GAGTCGTGTGGCAGGACGCTTCAAT
>probe:Drosophila_2:1627997_at:632:529; Interrogation_Position=949; Antisense; GGGATCTCTATCAGTATGCACGCCT
>probe:Drosophila_2:1627997_at:228:611; Interrogation_Position=992; Antisense; TGACCGGAGCTTTGTCCTGATGACC

Paste this into a BLAST search page for me
GAACTCGTCGAATCGGACACCCGTACGTACTTTGGTGCAGGCGAATCTCTGCGAATCTCTGCAACGTGGTGGTCAGGTGGTCATCCAACATTTGAACGAGGCTTCAGAACCCATCGTGCAATAAATGCACTGCCCGAAAACGAGCGATTTTATCGTCACTTGTCCCGGAAACAGTATGGGACCAGGTCGACCGCTGAACACAGATACTCGTCGTAGGCCCAATGCAAGGCCTTCAGCTCAACGAACGGGCCACGACCACCGTGCAGTTGAGGATGGAGTCGTGTGGCAGGACGCTTCAATGGGATCTCTATCAGTATGCACGCCTTGACCGGAGCTTTGTCCTGATGACC

Full Affymetrix probeset data:

Annotations for 1627997_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720