Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628001_at:

>probe:Drosophila_2:1628001_at:666:605; Interrogation_Position=3926; Antisense; TGATCTACTAACACCCTGTACTCTA
>probe:Drosophila_2:1628001_at:75:601; Interrogation_Position=3942; Antisense; TGTACTCTAGTTACTCCGCCATCTA
>probe:Drosophila_2:1628001_at:267:315; Interrogation_Position=3959; Antisense; GCCATCTATTTATTTGCTGCTCCTT
>probe:Drosophila_2:1628001_at:611:693; Interrogation_Position=3971; Antisense; TTTGCTGCTCCTTTGTTTAAACATG
>probe:Drosophila_2:1628001_at:620:255; Interrogation_Position=4120; Antisense; CACTCTTATGTGGATAGGGCGTACG
>probe:Drosophila_2:1628001_at:461:605; Interrogation_Position=4134; Antisense; TAGGGCGTACGTTACTGCTAAGCAC
>probe:Drosophila_2:1628001_at:162:145; Interrogation_Position=4147; Antisense; ACTGCTAAGCACTCTGTCTAATGAT
>probe:Drosophila_2:1628001_at:700:705; Interrogation_Position=4176; Antisense; TTATGTACTCACAACTTGAACCCCG
>probe:Drosophila_2:1628001_at:412:133; Interrogation_Position=4195; Antisense; ACCCCGATGGGCAACTGTATATGAA
>probe:Drosophila_2:1628001_at:477:299; Interrogation_Position=4273; Antisense; CGCCCACGGTTGACCACAAAATACA
>probe:Drosophila_2:1628001_at:252:165; Interrogation_Position=4291; Antisense; AAATACAATTGCCTGCCCTTAGTTT
>probe:Drosophila_2:1628001_at:571:319; Interrogation_Position=4305; Antisense; GCCCTTAGTTTCTTATGTATAGACG
>probe:Drosophila_2:1628001_at:381:239; Interrogation_Position=4400; Antisense; AATACACACTCTTCTGAGTTTGCTG
>probe:Drosophila_2:1628001_at:567:429; Interrogation_Position=4415; Antisense; GAGTTTGCTGCTAATGCGTAGGCAT

Paste this into a BLAST search page for me
TGATCTACTAACACCCTGTACTCTATGTACTCTAGTTACTCCGCCATCTAGCCATCTATTTATTTGCTGCTCCTTTTTGCTGCTCCTTTGTTTAAACATGCACTCTTATGTGGATAGGGCGTACGTAGGGCGTACGTTACTGCTAAGCACACTGCTAAGCACTCTGTCTAATGATTTATGTACTCACAACTTGAACCCCGACCCCGATGGGCAACTGTATATGAACGCCCACGGTTGACCACAAAATACAAAATACAATTGCCTGCCCTTAGTTTGCCCTTAGTTTCTTATGTATAGACGAATACACACTCTTCTGAGTTTGCTGGAGTTTGCTGCTAATGCGTAGGCAT

Full Affymetrix probeset data:

Annotations for 1628001_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime