FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628002_at:

>probe:Drosophila_2:1628002_at:306:115; Interrogation_Position=1966; Antisense; AGCAGACTCTGCGATTCGGCGACAA
>probe:Drosophila_2:1628002_at:349:391; Interrogation_Position=2008; Antisense; GAAACGGATCCCATAGAGACTCCTC
>probe:Drosophila_2:1628002_at:63:105; Interrogation_Position=2024; Antisense; AGACTCCTCCATTCGATGGCGGAAA
>probe:Drosophila_2:1628002_at:87:241; Interrogation_Position=2065; Antisense; AATAACATGGTCACGGATGCCGCCA
>probe:Drosophila_2:1628002_at:218:79; Interrogation_Position=2131; Antisense; AGGATTGTATATGTCGGCAGCTCGA
>probe:Drosophila_2:1628002_at:688:693; Interrogation_Position=2177; Antisense; TTTGCTACTATGGACAGGCGATCTT
>probe:Drosophila_2:1628002_at:162:453; Interrogation_Position=2196; Antisense; GATCTTGCAGGAGTGCAGCTCGCAA
>probe:Drosophila_2:1628002_at:101:21; Interrogation_Position=2252; Antisense; ATATTCCGGAGAGAGCCCAGTGCAC
>probe:Drosophila_2:1628002_at:118:533; Interrogation_Position=2329; Antisense; GGTGGCACCGCCATTTCGAGTGATC
>probe:Drosophila_2:1628002_at:572:601; Interrogation_Position=2384; Antisense; TGTATCCCCATATGCAGCGATGCGA
>probe:Drosophila_2:1628002_at:110:327; Interrogation_Position=2405; Antisense; GCGAGTTCTTTATCTACTGCGTCAA
>probe:Drosophila_2:1628002_at:358:361; Interrogation_Position=2448; Antisense; GCAATGTCCTTTCTATTACTTCTTC
>probe:Drosophila_2:1628002_at:655:707; Interrogation_Position=2463; Antisense; TTACTTCTTCGATATTGCCACCAAA
>probe:Drosophila_2:1628002_at:637:169; Interrogation_Position=2486; Antisense; AAAGTTGTCAATGGTCGCGCACGGC

Paste this into a BLAST search page for me
AGCAGACTCTGCGATTCGGCGACAAGAAACGGATCCCATAGAGACTCCTCAGACTCCTCCATTCGATGGCGGAAAAATAACATGGTCACGGATGCCGCCAAGGATTGTATATGTCGGCAGCTCGATTTGCTACTATGGACAGGCGATCTTGATCTTGCAGGAGTGCAGCTCGCAAATATTCCGGAGAGAGCCCAGTGCACGGTGGCACCGCCATTTCGAGTGATCTGTATCCCCATATGCAGCGATGCGAGCGAGTTCTTTATCTACTGCGTCAAGCAATGTCCTTTCTATTACTTCTTCTTACTTCTTCGATATTGCCACCAAAAAAGTTGTCAATGGTCGCGCACGGC

Full Affymetrix probeset data:

Annotations for 1628002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720