Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628005_at:

>probe:Drosophila_2:1628005_at:396:521; Interrogation_Position=4467; Antisense; GGGCCAAGTGAGGAGACCACTGCTC
>probe:Drosophila_2:1628005_at:126:579; Interrogation_Position=4495; Antisense; GGCCACCAGGATTCCAGGATTCCAG
>probe:Drosophila_2:1628005_at:63:465; Interrogation_Position=4512; Antisense; GATTCCAGGATCTGTGCTCGAGGAC
>probe:Drosophila_2:1628005_at:413:293; Interrogation_Position=4530; Antisense; CGAGGACAGACGAGTTTTGCTTTAA
>probe:Drosophila_2:1628005_at:542:189; Interrogation_Position=4561; Antisense; AACATTTTGCTTTGTGATTTTCGTA
>probe:Drosophila_2:1628005_at:535:703; Interrogation_Position=4591; Antisense; TTATGATTTCCCTTCCAGTTTAGGC
>probe:Drosophila_2:1628005_at:607:633; Interrogation_Position=4599; Antisense; TCCCTTCCAGTTTAGGCCTCAAAAT
>probe:Drosophila_2:1628005_at:36:675; Interrogation_Position=4626; Antisense; TATACAACTGCTTTTCGGCTACAAA
>probe:Drosophila_2:1628005_at:147:705; Interrogation_Position=4666; Antisense; TTCAATTCCGAATTCAGAAGTTTCT
>probe:Drosophila_2:1628005_at:517:11; Interrogation_Position=4854; Antisense; ATTCTAGCCAAGTGTGAAACATGTT
>probe:Drosophila_2:1628005_at:135:343; Interrogation_Position=4890; Antisense; GCAAATATTACGCAAAAACCACTCA
>probe:Drosophila_2:1628005_at:125:191; Interrogation_Position=4917; Antisense; AACGTTCTCAAAAACTTGATGGCAA
>probe:Drosophila_2:1628005_at:257:649; Interrogation_Position=4993; Antisense; TCAAACTTTTGGCACACCTTTGGAA
>probe:Drosophila_2:1628005_at:574:583; Interrogation_Position=5002; Antisense; TGGCACACCTTTGGAAAACATTTTT

Paste this into a BLAST search page for me
GGGCCAAGTGAGGAGACCACTGCTCGGCCACCAGGATTCCAGGATTCCAGGATTCCAGGATCTGTGCTCGAGGACCGAGGACAGACGAGTTTTGCTTTAAAACATTTTGCTTTGTGATTTTCGTATTATGATTTCCCTTCCAGTTTAGGCTCCCTTCCAGTTTAGGCCTCAAAATTATACAACTGCTTTTCGGCTACAAATTCAATTCCGAATTCAGAAGTTTCTATTCTAGCCAAGTGTGAAACATGTTGCAAATATTACGCAAAAACCACTCAAACGTTCTCAAAAACTTGATGGCAATCAAACTTTTGGCACACCTTTGGAATGGCACACCTTTGGAAAACATTTTT

Full Affymetrix probeset data:

Annotations for 1628005_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime