FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628006_at:

>probe:Drosophila_2:1628006_at:687:203; Interrogation_Position=124; Antisense; AAGCCCTTCCTGAACGGCCTGACGG
>probe:Drosophila_2:1628006_at:596:279; Interrogation_Position=204; Antisense; CTCCGTCGACGGCTACATGAACATG
>probe:Drosophila_2:1628006_at:469:613; Interrogation_Position=221; Antisense; TGAACATGCAGCTGGCGAACACGGA
>probe:Drosophila_2:1628006_at:25:375; Interrogation_Position=25; Antisense; GAAAAGCCGGCGATTTTCGGCACGC
>probe:Drosophila_2:1628006_at:325:41; Interrogation_Position=253; Antisense; ATCGAGGGCTCCGTGACTGGTAATC
>probe:Drosophila_2:1628006_at:259:407; Interrogation_Position=267; Antisense; GACTGGTAATCTTGGCGAGGTGCTC
>probe:Drosophila_2:1628006_at:664:729; Interrogation_Position=278; Antisense; TTGGCGAGGTGCTCATCCGCTGCAA
>probe:Drosophila_2:1628006_at:281:47; Interrogation_Position=292; Antisense; ATCCGCTGCAACAACGTGCTGTATA
>probe:Drosophila_2:1628006_at:727:139; Interrogation_Position=305; Antisense; ACGTGCTGTATATCAAGGGCATGGA
>probe:Drosophila_2:1628006_at:320:233; Interrogation_Position=351; Antisense; AATGCGCGACTAGCCAATGGATTCA
>probe:Drosophila_2:1628006_at:111:229; Interrogation_Position=366; Antisense; AATGGATTCACCTACATACACCCAC
>probe:Drosophila_2:1628006_at:352:307; Interrogation_Position=387; Antisense; CCACACCTTACTTCTAAGTCTACAA
>probe:Drosophila_2:1628006_at:429:717; Interrogation_Position=40; Antisense; TTCGGCACGCTTGTTGTAATATTTT
>probe:Drosophila_2:1628006_at:640:369; Interrogation_Position=95; Antisense; GAATGTCGGCTGGTATGCCCATTAA

Paste this into a BLAST search page for me
AAGCCCTTCCTGAACGGCCTGACGGCTCCGTCGACGGCTACATGAACATGTGAACATGCAGCTGGCGAACACGGAGAAAAGCCGGCGATTTTCGGCACGCATCGAGGGCTCCGTGACTGGTAATCGACTGGTAATCTTGGCGAGGTGCTCTTGGCGAGGTGCTCATCCGCTGCAAATCCGCTGCAACAACGTGCTGTATAACGTGCTGTATATCAAGGGCATGGAAATGCGCGACTAGCCAATGGATTCAAATGGATTCACCTACATACACCCACCCACACCTTACTTCTAAGTCTACAATTCGGCACGCTTGTTGTAATATTTTGAATGTCGGCTGGTATGCCCATTAA

Full Affymetrix probeset data:

Annotations for 1628006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720