Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628009_at:

>probe:Drosophila_2:1628009_at:460:153; Interrogation_Position=5433; Antisense; ACACTTTTAGCCGTAAACGCAGCCT
>probe:Drosophila_2:1628009_at:588:491; Interrogation_Position=5445; Antisense; GTAAACGCAGCCTCGGCGATCTGGC
>probe:Drosophila_2:1628009_at:359:575; Interrogation_Position=5459; Antisense; GGCGATCTGGCCACAAAATTCGGTA
>probe:Drosophila_2:1628009_at:683:253; Interrogation_Position=5472; Antisense; CAAAATTCGGTATCTATGAGCGGAT
>probe:Drosophila_2:1628009_at:407:191; Interrogation_Position=5540; Antisense; AACTATTAAGCGACTCCGTTCACTG
>probe:Drosophila_2:1628009_at:489:293; Interrogation_Position=5556; Antisense; CGTTCACTGCCCAGCAACGCAATAA
>probe:Drosophila_2:1628009_at:316:199; Interrogation_Position=5571; Antisense; AACGCAATAACTCCGCATTCTTGGC
>probe:Drosophila_2:1628009_at:549:343; Interrogation_Position=5585; Antisense; GCATTCTTGGCAACAGGCGGACTGT
>probe:Drosophila_2:1628009_at:142:329; Interrogation_Position=5601; Antisense; GCGGACTGTTACGTTTAAGCCAACT
>probe:Drosophila_2:1628009_at:190:711; Interrogation_Position=5615; Antisense; TTAAGCCAACTTCGCAGGCCAATTG
>probe:Drosophila_2:1628009_at:51:167; Interrogation_Position=5658; Antisense; AAAGGTCAGAATGGTCCGGAGGTCA
>probe:Drosophila_2:1628009_at:105:349; Interrogation_Position=5701; Antisense; GCAGGGCAGCCTGCCGAGGAAATTT
>probe:Drosophila_2:1628009_at:722:179; Interrogation_Position=5778; Antisense; AAAACACAAGCCGAGCAGAATGCAA
>probe:Drosophila_2:1628009_at:323:257; Interrogation_Position=5879; Antisense; CACACATGACACACCACACAGAAAT

Paste this into a BLAST search page for me
ACACTTTTAGCCGTAAACGCAGCCTGTAAACGCAGCCTCGGCGATCTGGCGGCGATCTGGCCACAAAATTCGGTACAAAATTCGGTATCTATGAGCGGATAACTATTAAGCGACTCCGTTCACTGCGTTCACTGCCCAGCAACGCAATAAAACGCAATAACTCCGCATTCTTGGCGCATTCTTGGCAACAGGCGGACTGTGCGGACTGTTACGTTTAAGCCAACTTTAAGCCAACTTCGCAGGCCAATTGAAAGGTCAGAATGGTCCGGAGGTCAGCAGGGCAGCCTGCCGAGGAAATTTAAAACACAAGCCGAGCAGAATGCAACACACATGACACACCACACAGAAAT

Full Affymetrix probeset data:

Annotations for 1628009_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime