FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628010_at:

>probe:Drosophila_2:1628010_at:587:519; Interrogation_Position=130; Antisense; GTGGACGTTGATGGCATTGCAGATA
>probe:Drosophila_2:1628010_at:170:683; Interrogation_Position=181; Antisense; TATAACTACAACAAAGCACCGGCCA
>probe:Drosophila_2:1628010_at:305:113; Interrogation_Position=195; Antisense; AGCACCGGCCAAATGGCAGCAGCAA
>probe:Drosophila_2:1628010_at:173:179; Interrogation_Position=229; Antisense; AAACTCTACGGAAATCCCATCCACA
>probe:Drosophila_2:1628010_at:84:49; Interrogation_Position=247; Antisense; ATCCACAGCATATACGACAGGCAGC
>probe:Drosophila_2:1628010_at:474:295; Interrogation_Position=261; Antisense; CGACAGGCAGCAACATCTACAACGG
>probe:Drosophila_2:1628010_at:360:99; Interrogation_Position=402; Antisense; AGAGAATGCTCGCAACGACTTCCGT
>probe:Drosophila_2:1628010_at:227:719; Interrogation_Position=421; Antisense; TTCCGTCTGCAATTGTCCGACTTAA
>probe:Drosophila_2:1628010_at:378:629; Interrogation_Position=436; Antisense; TCCGACTTAAATGCGGCCGTTCAAG
>probe:Drosophila_2:1628010_at:419:297; Interrogation_Position=452; Antisense; CCGTTCAAGGTATGGGCAGGTTTGC
>probe:Drosophila_2:1628010_at:409:79; Interrogation_Position=469; Antisense; AGGTTTGCTGTTACCCAGGACCAGA
>probe:Drosophila_2:1628010_at:78:113; Interrogation_Position=565; Antisense; AGCAACATCGACTGGCTGCAGCCGA
>probe:Drosophila_2:1628010_at:352:249; Interrogation_Position=604; Antisense; CAATTGTTGCTGGAGCGTCGCAGCC
>probe:Drosophila_2:1628010_at:298:379; Interrogation_Position=74; Antisense; GAAGCGCCACGGACAACAACTACAA

Paste this into a BLAST search page for me
GTGGACGTTGATGGCATTGCAGATATATAACTACAACAAAGCACCGGCCAAGCACCGGCCAAATGGCAGCAGCAAAAACTCTACGGAAATCCCATCCACAATCCACAGCATATACGACAGGCAGCCGACAGGCAGCAACATCTACAACGGAGAGAATGCTCGCAACGACTTCCGTTTCCGTCTGCAATTGTCCGACTTAATCCGACTTAAATGCGGCCGTTCAAGCCGTTCAAGGTATGGGCAGGTTTGCAGGTTTGCTGTTACCCAGGACCAGAAGCAACATCGACTGGCTGCAGCCGACAATTGTTGCTGGAGCGTCGCAGCCGAAGCGCCACGGACAACAACTACAA

Full Affymetrix probeset data:

Annotations for 1628010_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720