FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628013_at:

>probe:Drosophila_2:1628013_at:440:677; Interrogation_Position=1009; Antisense; TAGAGAAACGCCTGCTCGAGAGTCC
>probe:Drosophila_2:1628013_at:528:637; Interrogation_Position=1024; Antisense; TCGAGAGTCCCAAATTCACGCATGC
>probe:Drosophila_2:1628013_at:704:259; Interrogation_Position=1040; Antisense; CACGCATGCCGAAAGTCTAGAGTTA
>probe:Drosophila_2:1628013_at:70:49; Interrogation_Position=639; Antisense; ATCCTTATGGACATCGGCATCTACG
>probe:Drosophila_2:1628013_at:159:261; Interrogation_Position=669; Antisense; CAGCTGGGTCAGTTCGTTTTCGGTG
>probe:Drosophila_2:1628013_at:572:701; Interrogation_Position=685; Antisense; TTTTCGGTGTATCTCCCGTCAAGAT
>probe:Drosophila_2:1628013_at:412:135; Interrogation_Position=740; Antisense; ACGCGTGGATGTGCAGATCGACTTT
>probe:Drosophila_2:1628013_at:71:449; Interrogation_Position=755; Antisense; GATCGACTTTATGCTGGACTATGGC
>probe:Drosophila_2:1628013_at:416:147; Interrogation_Position=772; Antisense; ACTATGGCGATGGTCGTCGACTGGT
>probe:Drosophila_2:1628013_at:675:405; Interrogation_Position=790; Antisense; GACTGGTGGCTCTAGTAACCGGACT
>probe:Drosophila_2:1628013_at:265:497; Interrogation_Position=837; Antisense; GTCATCACGGGCACCAAAGGCGAGA
>probe:Drosophila_2:1628013_at:444:207; Interrogation_Position=864; Antisense; AAGCTGTCCAATTACTGGTGCTGCA
>probe:Drosophila_2:1628013_at:692:623; Interrogation_Position=931; Antisense; TGCCGCGGGCCAAATTTGATTTCCA
>probe:Drosophila_2:1628013_at:245:665; Interrogation_Position=957; Antisense; TACACGAACACCTGCGGACTGAGAT

Paste this into a BLAST search page for me
TAGAGAAACGCCTGCTCGAGAGTCCTCGAGAGTCCCAAATTCACGCATGCCACGCATGCCGAAAGTCTAGAGTTAATCCTTATGGACATCGGCATCTACGCAGCTGGGTCAGTTCGTTTTCGGTGTTTTCGGTGTATCTCCCGTCAAGATACGCGTGGATGTGCAGATCGACTTTGATCGACTTTATGCTGGACTATGGCACTATGGCGATGGTCGTCGACTGGTGACTGGTGGCTCTAGTAACCGGACTGTCATCACGGGCACCAAAGGCGAGAAAGCTGTCCAATTACTGGTGCTGCATGCCGCGGGCCAAATTTGATTTCCATACACGAACACCTGCGGACTGAGAT

Full Affymetrix probeset data:

Annotations for 1628013_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720