Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628014_at:

>probe:Drosophila_2:1628014_at:713:379; Interrogation_Position=1018; Antisense; GAACCTATCACTGATTGTCGAACGA
>probe:Drosophila_2:1628014_at:75:59; Interrogation_Position=485; Antisense; ATGATCCCGCTGCTTGATCTGGCAC
>probe:Drosophila_2:1628014_at:496:309; Interrogation_Position=529; Antisense; GCCAATCTCTGCCATGCACAAGGTG
>probe:Drosophila_2:1628014_at:497:257; Interrogation_Position=545; Antisense; CACAAGGTGGCCGAGATTCTCCAGT
>probe:Drosophila_2:1628014_at:538:95; Interrogation_Position=558; Antisense; AGATTCTCCAGTTGCCCAATATGCG
>probe:Drosophila_2:1628014_at:534:241; Interrogation_Position=575; Antisense; AATATGCGCGTCTACGAGGTGGCCA
>probe:Drosophila_2:1628014_at:568:81; Interrogation_Position=591; Antisense; AGGTGGCCACTTTCTATACGATGTT
>probe:Drosophila_2:1628014_at:535:205; Interrogation_Position=623; Antisense; AAGCCCACTGGCAAGTATCACATCC
>probe:Drosophila_2:1628014_at:76:411; Interrogation_Position=686; Antisense; GACGACATCCTGGAGACCTGCAAGA
>probe:Drosophila_2:1628014_at:691:639; Interrogation_Position=729; Antisense; TCGGCGACACCACCAAGGACAGGAA
>probe:Drosophila_2:1628014_at:89:651; Interrogation_Position=756; Antisense; TCACCATCTCGGAGGTCGAGTGCTT
>probe:Drosophila_2:1628014_at:107:317; Interrogation_Position=785; Antisense; GCCTGTGTCAATGCGCCAATGGTGG
>probe:Drosophila_2:1628014_at:376:533; Interrogation_Position=805; Antisense; GGTGGCGATCAACGATGACTACTAT
>probe:Drosophila_2:1628014_at:60:401; Interrogation_Position=857; Antisense; GACATCCTGAACGACCTGAAGGCGG

Paste this into a BLAST search page for me
GAACCTATCACTGATTGTCGAACGAATGATCCCGCTGCTTGATCTGGCACGCCAATCTCTGCCATGCACAAGGTGCACAAGGTGGCCGAGATTCTCCAGTAGATTCTCCAGTTGCCCAATATGCGAATATGCGCGTCTACGAGGTGGCCAAGGTGGCCACTTTCTATACGATGTTAAGCCCACTGGCAAGTATCACATCCGACGACATCCTGGAGACCTGCAAGATCGGCGACACCACCAAGGACAGGAATCACCATCTCGGAGGTCGAGTGCTTGCCTGTGTCAATGCGCCAATGGTGGGGTGGCGATCAACGATGACTACTATGACATCCTGAACGACCTGAAGGCGG

Full Affymetrix probeset data:

Annotations for 1628014_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime