Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628018_at:

>probe:Drosophila_2:1628018_at:34:439; Interrogation_Position=11189; Antisense; GATGGCCAATTTTTGGTTACCACCT
>probe:Drosophila_2:1628018_at:398:501; Interrogation_Position=11226; Antisense; GTCCGGATGTGGGTAGTTGCCTATC
>probe:Drosophila_2:1628018_at:25:279; Interrogation_Position=11246; Antisense; CTATCCCACCTGTTGTACCAAGATG
>probe:Drosophila_2:1628018_at:180:37; Interrogation_Position=11314; Antisense; ATCATCTTGTTTACCCGTTTCCTTG
>probe:Drosophila_2:1628018_at:160:693; Interrogation_Position=11331; Antisense; TTTCCTTGGCCGAGTCGCGTACGAA
>probe:Drosophila_2:1628018_at:695:95; Interrogation_Position=11358; Antisense; AGATTCTCAAGTTCCCTGTGCAAGG
>probe:Drosophila_2:1628018_at:550:385; Interrogation_Position=11388; Antisense; GAACATGTGTGAATGCCGATCCCAT
>probe:Drosophila_2:1628018_at:388:11; Interrogation_Position=11411; Antisense; ATTCAGGGCTTCACCGACTGCGAGG
>probe:Drosophila_2:1628018_at:266:621; Interrogation_Position=11441; Antisense; TGCTCCTCTGGTTCCAAGTACAATA
>probe:Drosophila_2:1628018_at:203:375; Interrogation_Position=11485; Antisense; GAAGTTCTGTACTTGCTGCAGCATA
>probe:Drosophila_2:1628018_at:642:47; Interrogation_Position=11512; Antisense; ATCCTATCATCCGATTTCCGTGAAA
>probe:Drosophila_2:1628018_at:493:477; Interrogation_Position=11614; Antisense; GTTTTCGGACTCTGCAATCGATGTG
>probe:Drosophila_2:1628018_at:302:233; Interrogation_Position=11641; Antisense; AATGCAGCAGGATGCGCAGTCTCCA
>probe:Drosophila_2:1628018_at:286:665; Interrogation_Position=11667; Antisense; TACTCCAATTACTCGGCAACCATAG

Paste this into a BLAST search page for me
GATGGCCAATTTTTGGTTACCACCTGTCCGGATGTGGGTAGTTGCCTATCCTATCCCACCTGTTGTACCAAGATGATCATCTTGTTTACCCGTTTCCTTGTTTCCTTGGCCGAGTCGCGTACGAAAGATTCTCAAGTTCCCTGTGCAAGGGAACATGTGTGAATGCCGATCCCATATTCAGGGCTTCACCGACTGCGAGGTGCTCCTCTGGTTCCAAGTACAATAGAAGTTCTGTACTTGCTGCAGCATAATCCTATCATCCGATTTCCGTGAAAGTTTTCGGACTCTGCAATCGATGTGAATGCAGCAGGATGCGCAGTCTCCATACTCCAATTACTCGGCAACCATAG

Full Affymetrix probeset data:

Annotations for 1628018_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime