Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628019_a_at:

>probe:Drosophila_2:1628019_a_at:722:499; Interrogation_Position=2222; Antisense; GTCGGTTCACAAAGCGCGTTTACGT
>probe:Drosophila_2:1628019_a_at:487:85; Interrogation_Position=2308; Antisense; AGTCCGTTGGATACCGAGGCGTTGC
>probe:Drosophila_2:1628019_a_at:40:329; Interrogation_Position=2326; Antisense; GCGTTGCGTCGCCTTGCAAAGATAA
>probe:Drosophila_2:1628019_a_at:353:455; Interrogation_Position=2346; Antisense; GATAACAGACGGATACTCGGGCTCC
>probe:Drosophila_2:1628019_a_at:19:225; Interrogation_Position=2389; Antisense; AAGGACGCCGCATTGGAGCCCATTC
>probe:Drosophila_2:1628019_a_at:57:517; Interrogation_Position=2439; Antisense; GTGTCTGGACATCAGTGCAATGCGT
>probe:Drosophila_2:1628019_a_at:512:115; Interrogation_Position=2474; Antisense; AGCAGGACTTTCACAGTTCGCTCAA
>probe:Drosophila_2:1628019_a_at:486:295; Interrogation_Position=2565; Antisense; CGACATCACCATCTAGTCTGTTCTA
>probe:Drosophila_2:1628019_a_at:484:677; Interrogation_Position=2578; Antisense; TAGTCTGTTCTAGCCAATGATCCTG
>probe:Drosophila_2:1628019_a_at:460:63; Interrogation_Position=2637; Antisense; ATGTGAGTCTCAGAGCGCAACCCAT
>probe:Drosophila_2:1628019_a_at:470:359; Interrogation_Position=2653; Antisense; GCAACCCATTGTCGTTACACTAGTT
>probe:Drosophila_2:1628019_a_at:267:15; Interrogation_Position=2681; Antisense; ATTATGTGACCCATGTTTTTCGCCC
>probe:Drosophila_2:1628019_a_at:167:1; Interrogation_Position=2702; Antisense; GCCCTTAAGGTTCTATTCAATCCGT
>probe:Drosophila_2:1628019_a_at:107:249; Interrogation_Position=2719; Antisense; CAATCCGTAGACTTTTCGTTTCACA

Paste this into a BLAST search page for me
GTCGGTTCACAAAGCGCGTTTACGTAGTCCGTTGGATACCGAGGCGTTGCGCGTTGCGTCGCCTTGCAAAGATAAGATAACAGACGGATACTCGGGCTCCAAGGACGCCGCATTGGAGCCCATTCGTGTCTGGACATCAGTGCAATGCGTAGCAGGACTTTCACAGTTCGCTCAACGACATCACCATCTAGTCTGTTCTATAGTCTGTTCTAGCCAATGATCCTGATGTGAGTCTCAGAGCGCAACCCATGCAACCCATTGTCGTTACACTAGTTATTATGTGACCCATGTTTTTCGCCCGCCCTTAAGGTTCTATTCAATCCGTCAATCCGTAGACTTTTCGTTTCACA

Full Affymetrix probeset data:

Annotations for 1628019_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime