FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628020_at:

>probe:Drosophila_2:1628020_at:494:565; Interrogation_Position=1000; Antisense; GGCAATCAGCACTGCGTTGATCTTT
>probe:Drosophila_2:1628020_at:464:609; Interrogation_Position=1061; Antisense; TGAGCTACTTCATATGCCAGTCCGA
>probe:Drosophila_2:1628020_at:583:517; Interrogation_Position=519; Antisense; GTGGACTTCGAGTGTTCTGCAAGCG
>probe:Drosophila_2:1628020_at:379:103; Interrogation_Position=559; Antisense; AGACTGGCCAGGATCGAGACTCTGC
>probe:Drosophila_2:1628020_at:44:425; Interrogation_Position=574; Antisense; GAGACTCTGCAGACGGCGATGAACA
>probe:Drosophila_2:1628020_at:305:223; Interrogation_Position=607; Antisense; AAGGTCCTGCAAGAGGGCTTCCCTA
>probe:Drosophila_2:1628020_at:366:569; Interrogation_Position=622; Antisense; GGCTTCCCTAAGGACATCGTGGCGA
>probe:Drosophila_2:1628020_at:469:329; Interrogation_Position=684; Antisense; GCGGATACTCTCCAAGTTCGATAGG
>probe:Drosophila_2:1628020_at:643:239; Interrogation_Position=711; Antisense; AATAGTTGCGCCCAAGTTCGAGCTA
>probe:Drosophila_2:1628020_at:607:235; Interrogation_Position=735; Antisense; AATCGGCTCGAGGTTCTTCTACATA
>probe:Drosophila_2:1628020_at:407:199; Interrogation_Position=768; Antisense; AACGCGTAGGAACTGGACCTCGGCT
>probe:Drosophila_2:1628020_at:287:75; Interrogation_Position=878; Antisense; AGGAGCGACACTACTGGCTGGACAT
>probe:Drosophila_2:1628020_at:27:575; Interrogation_Position=893; Antisense; GGCTGGACATCACCGATCTGGAGAA
>probe:Drosophila_2:1628020_at:412:433; Interrogation_Position=919; Antisense; GAGGGCGACTTCAGAATCTCCGCGT

Paste this into a BLAST search page for me
GGCAATCAGCACTGCGTTGATCTTTTGAGCTACTTCATATGCCAGTCCGAGTGGACTTCGAGTGTTCTGCAAGCGAGACTGGCCAGGATCGAGACTCTGCGAGACTCTGCAGACGGCGATGAACAAAGGTCCTGCAAGAGGGCTTCCCTAGGCTTCCCTAAGGACATCGTGGCGAGCGGATACTCTCCAAGTTCGATAGGAATAGTTGCGCCCAAGTTCGAGCTAAATCGGCTCGAGGTTCTTCTACATAAACGCGTAGGAACTGGACCTCGGCTAGGAGCGACACTACTGGCTGGACATGGCTGGACATCACCGATCTGGAGAAGAGGGCGACTTCAGAATCTCCGCGT

Full Affymetrix probeset data:

Annotations for 1628020_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720