Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628021_at:

>probe:Drosophila_2:1628021_at:360:711; Interrogation_Position=1958; Antisense; TTCAAAGTTCTCGAAGACCAAGTCT
>probe:Drosophila_2:1628021_at:158:103; Interrogation_Position=1972; Antisense; AGACCAAGTCTAGCGTCGGTGCACA
>probe:Drosophila_2:1628021_at:642:639; Interrogation_Position=2008; Antisense; TCGGTGCGCAGCTACAGCATGATGC
>probe:Drosophila_2:1628021_at:136:615; Interrogation_Position=2075; Antisense; TGAAGCTGCGACTGGCGCGATTGCA
>probe:Drosophila_2:1628021_at:468:387; Interrogation_Position=2121; Antisense; GAACAAGCCGCAGATTGTCATCGGT
>probe:Drosophila_2:1628021_at:523:467; Interrogation_Position=2151; Antisense; GTTGATGCAACATGGCGCCCTCAGT
>probe:Drosophila_2:1628021_at:286:411; Interrogation_Position=2205; Antisense; GACGCCCAACTCACTGGACGAGCTG
>probe:Drosophila_2:1628021_at:143:611; Interrogation_Position=2244; Antisense; TGAAAACCAGGAGTATCCTCCCCGG
>probe:Drosophila_2:1628021_at:473:573; Interrogation_Position=2267; Antisense; GGCTGGAAGCAACCCTTAAACAGTT
>probe:Drosophila_2:1628021_at:128:663; Interrogation_Position=2283; Antisense; TAAACAGTTCATACAGCCTCAGGCC
>probe:Drosophila_2:1628021_at:597:289; Interrogation_Position=2310; Antisense; CGGAGCGTCAGGTTCCTCTGGAGCC
>probe:Drosophila_2:1628021_at:393:693; Interrogation_Position=2343; Antisense; TTTGAGAGCAGCTGCCTCCCAATCA
>probe:Drosophila_2:1628021_at:478:647; Interrogation_Position=2365; Antisense; TCATCGCCAGGCACTTCGAATGGAT
>probe:Drosophila_2:1628021_at:420:263; Interrogation_Position=2403; Antisense; CAGCTCCTCGACTGAGGCTCTTTAA

Paste this into a BLAST search page for me
TTCAAAGTTCTCGAAGACCAAGTCTAGACCAAGTCTAGCGTCGGTGCACATCGGTGCGCAGCTACAGCATGATGCTGAAGCTGCGACTGGCGCGATTGCAGAACAAGCCGCAGATTGTCATCGGTGTTGATGCAACATGGCGCCCTCAGTGACGCCCAACTCACTGGACGAGCTGTGAAAACCAGGAGTATCCTCCCCGGGGCTGGAAGCAACCCTTAAACAGTTTAAACAGTTCATACAGCCTCAGGCCCGGAGCGTCAGGTTCCTCTGGAGCCTTTGAGAGCAGCTGCCTCCCAATCATCATCGCCAGGCACTTCGAATGGATCAGCTCCTCGACTGAGGCTCTTTAA

Full Affymetrix probeset data:

Annotations for 1628021_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime