FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628025_at:

>probe:Drosophila_2:1628025_at:390:77; Interrogation_Position=347; Antisense; AGGAGGACGCGCACAGTTCATCGAC
>probe:Drosophila_2:1628025_at:351:119; Interrogation_Position=422; Antisense; AGCTGATGTCCATGTCGTGCGCCTC
>probe:Drosophila_2:1628025_at:102:177; Interrogation_Position=452; Antisense; AAACGAGCAGCACGCTGGACATCGA
>probe:Drosophila_2:1628025_at:461:115; Interrogation_Position=503; Antisense; AGCAGGCGCAGCAATCGAAACGGAA
>probe:Drosophila_2:1628025_at:423:561; Interrogation_Position=524; Antisense; GGAAGCCGATTAGCCGAGCCAGTTT
>probe:Drosophila_2:1628025_at:673:113; Interrogation_Position=678; Antisense; AGCAGCTGCATTGCCTTTGAAGTCG
>probe:Drosophila_2:1628025_at:87:711; Interrogation_Position=694; Antisense; TTGAAGTCGGCTCTCAAATCCGCAT
>probe:Drosophila_2:1628025_at:485:43; Interrogation_Position=717; Antisense; ATCGAATGTCGAGCTGCACAGGCAG
>probe:Drosophila_2:1628025_at:152:183; Interrogation_Position=755; Antisense; AAAAGCAACCAACCGGCAGGTCATC
>probe:Drosophila_2:1628025_at:151:79; Interrogation_Position=772; Antisense; AGGTCATCATCATCGTGCTGCGGTT
>probe:Drosophila_2:1628025_at:44:281; Interrogation_Position=789; Antisense; CTGCGGTTCGGCGTCTAAGAACAAC
>probe:Drosophila_2:1628025_at:393:379; Interrogation_Position=819; Antisense; GAAGCCGCCGCCACAAAGGATCCTG
>probe:Drosophila_2:1628025_at:233:23; Interrogation_Position=864; Antisense; ATATCTCAAAGGCATGTCCGGCCTG
>probe:Drosophila_2:1628025_at:266:119; Interrogation_Position=910; Antisense; AGCTCTGTGTGCTGTCAGTACGCCA

Paste this into a BLAST search page for me
AGGAGGACGCGCACAGTTCATCGACAGCTGATGTCCATGTCGTGCGCCTCAAACGAGCAGCACGCTGGACATCGAAGCAGGCGCAGCAATCGAAACGGAAGGAAGCCGATTAGCCGAGCCAGTTTAGCAGCTGCATTGCCTTTGAAGTCGTTGAAGTCGGCTCTCAAATCCGCATATCGAATGTCGAGCTGCACAGGCAGAAAAGCAACCAACCGGCAGGTCATCAGGTCATCATCATCGTGCTGCGGTTCTGCGGTTCGGCGTCTAAGAACAACGAAGCCGCCGCCACAAAGGATCCTGATATCTCAAAGGCATGTCCGGCCTGAGCTCTGTGTGCTGTCAGTACGCCA

Full Affymetrix probeset data:

Annotations for 1628025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720