Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628028_s_at:

>probe:Drosophila_2:1628028_s_at:349:597; Interrogation_Position=292; Antisense; TGTGCCCAGGCCAAGCAGTGGAAGA
>probe:Drosophila_2:1628028_s_at:335:135; Interrogation_Position=319; Antisense; ACGCAGGGTCGCTGGCCCAAGAAGT
>probe:Drosophila_2:1628028_s_at:716:209; Interrogation_Position=337; Antisense; AAGAAGTCCGCCGAGTTCCTGCTGC
>probe:Drosophila_2:1628028_s_at:535:69; Interrogation_Position=380; Antisense; AGGCCAACGCTGATTGCAAGGGTCT
>probe:Drosophila_2:1628028_s_at:357:587; Interrogation_Position=419; Antisense; TGGTCGTCCACCACATTCAGGTGAA
>probe:Drosophila_2:1628028_s_at:701:149; Interrogation_Position=431; Antisense; ACATTCAGGTGAACCGCGCTCAGTG
>probe:Drosophila_2:1628028_s_at:587:65; Interrogation_Position=482; Antisense; ATGGTCGCATCAATCCCTACATGTC
>probe:Drosophila_2:1628028_s_at:602:501; Interrogation_Position=520; Antisense; GTCGAGGTCATCCTCACCGAGAAGG
>probe:Drosophila_2:1628028_s_at:619:75; Interrogation_Position=545; Antisense; AGGAGCTTGTCTCCAAGGCCACTGA
>probe:Drosophila_2:1628028_s_at:244:241; Interrogation_Position=641; Antisense; AATAAAATGTGTTCTGGGCCAGCCG
>probe:Drosophila_2:1628028_s_at:214:535; Interrogation_Position=674; Antisense; GGTGACAACTACTGAAGCTCCATTC
>probe:Drosophila_2:1628028_s_at:508:365; Interrogation_Position=767; Antisense; GAATACAGAGCACAAGCCCCAGATT
>probe:Drosophila_2:1628028_s_at:579:413; Interrogation_Position=793; Antisense; GACCTCCTGGAAATGCTATGCGTTT
>probe:Drosophila_2:1628028_s_at:117:623; Interrogation_Position=811; Antisense; TGCGTTTTGTGTTTAACTCAACCCA

Paste this into a BLAST search page for me
TGTGCCCAGGCCAAGCAGTGGAAGAACGCAGGGTCGCTGGCCCAAGAAGTAAGAAGTCCGCCGAGTTCCTGCTGCAGGCCAACGCTGATTGCAAGGGTCTTGGTCGTCCACCACATTCAGGTGAAACATTCAGGTGAACCGCGCTCAGTGATGGTCGCATCAATCCCTACATGTCGTCGAGGTCATCCTCACCGAGAAGGAGGAGCTTGTCTCCAAGGCCACTGAAATAAAATGTGTTCTGGGCCAGCCGGGTGACAACTACTGAAGCTCCATTCGAATACAGAGCACAAGCCCCAGATTGACCTCCTGGAAATGCTATGCGTTTTGCGTTTTGTGTTTAACTCAACCCA

Full Affymetrix probeset data:

Annotations for 1628028_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime