Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628029_at:

>probe:Drosophila_2:1628029_at:470:73; Interrogation_Position=1204; Antisense; AGGAACCCAGTATGTGCAGCCGAAC
>probe:Drosophila_2:1628029_at:311:381; Interrogation_Position=1225; Antisense; GAACCGACTTATGTGGCCGCAAAAT
>probe:Drosophila_2:1628029_at:186:673; Interrogation_Position=1357; Antisense; TACGCGTCCTTCTTTTTGTTTCTAT
>probe:Drosophila_2:1628029_at:425:463; Interrogation_Position=1385; Antisense; GATTCTTAACATTTGTCGTCTCGTA
>probe:Drosophila_2:1628029_at:170:501; Interrogation_Position=1399; Antisense; GTCGTCTCGTAAAAGTTGCTGCCAA
>probe:Drosophila_2:1628029_at:74:251; Interrogation_Position=1421; Antisense; CAATCTTCTTGCGTTTCTGACTGCG
>probe:Drosophila_2:1628029_at:415:527; Interrogation_Position=1451; Antisense; GGGAGCGTTTTTGCTTTGCAGTCAA
>probe:Drosophila_2:1628029_at:88:721; Interrogation_Position=1466; Antisense; TTGCAGTCAACCGAGGAGCCTTTGA
>probe:Drosophila_2:1628029_at:399:415; Interrogation_Position=1481; Antisense; GAGCCTTTGAAGTGCTGGGTCCATC
>probe:Drosophila_2:1628029_at:310:263; Interrogation_Position=1538; Antisense; CAGGTTGTATTTTGGCCACTCGGAA
>probe:Drosophila_2:1628029_at:114:693; Interrogation_Position=1600; Antisense; TTTGACTTGGCCTTCTTGTGCACAA
>probe:Drosophila_2:1628029_at:434:199; Interrogation_Position=1623; Antisense; AACGCGTTGCAAGTCCTCATTGTAC
>probe:Drosophila_2:1628029_at:213:519; Interrogation_Position=1710; Antisense; GTGGATGCGAGCCTTTTTCTTTGCC
>probe:Drosophila_2:1628029_at:297:639; Interrogation_Position=1741; Antisense; TCGGCCTTCTGTTGCTCTAAAAGCT

Paste this into a BLAST search page for me
AGGAACCCAGTATGTGCAGCCGAACGAACCGACTTATGTGGCCGCAAAATTACGCGTCCTTCTTTTTGTTTCTATGATTCTTAACATTTGTCGTCTCGTAGTCGTCTCGTAAAAGTTGCTGCCAACAATCTTCTTGCGTTTCTGACTGCGGGGAGCGTTTTTGCTTTGCAGTCAATTGCAGTCAACCGAGGAGCCTTTGAGAGCCTTTGAAGTGCTGGGTCCATCCAGGTTGTATTTTGGCCACTCGGAATTTGACTTGGCCTTCTTGTGCACAAAACGCGTTGCAAGTCCTCATTGTACGTGGATGCGAGCCTTTTTCTTTGCCTCGGCCTTCTGTTGCTCTAAAAGCT

Full Affymetrix probeset data:

Annotations for 1628029_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime