FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628030_at:

>probe:Drosophila_2:1628030_at:447:55; Interrogation_Position=1025; Antisense; ATGACTTTTGTGGTCGCATCCAGAA
>probe:Drosophila_2:1628030_at:367:47; Interrogation_Position=1078; Antisense; ATCCGGCTACCTGGCGAACTGGAGA
>probe:Drosophila_2:1628030_at:15:329; Interrogation_Position=1131; Antisense; GCGGGCTTTAGCCTATCCGAATAGT
>probe:Drosophila_2:1628030_at:588:167; Interrogation_Position=1184; Antisense; AAAGGCTGTGCGTAAAACCCATCGA
>probe:Drosophila_2:1628030_at:264:183; Interrogation_Position=1197; Antisense; AAAACCCATCGAGCTGGCTTTTGAT
>probe:Drosophila_2:1628030_at:4:685; Interrogation_Position=691; Antisense; TTTGTTCTAGACATGGCGACCAGCG
>probe:Drosophila_2:1628030_at:51:603; Interrogation_Position=805; Antisense; TGTTTTCCCAGCTTGGCCTTAAGGA
>probe:Drosophila_2:1628030_at:370:575; Interrogation_Position=819; Antisense; GGCCTTAAGGACACCATTACTATTT
>probe:Drosophila_2:1628030_at:8:149; Interrogation_Position=837; Antisense; ACTATTTCCTGCTGGTGGTCACAAA
>probe:Drosophila_2:1628030_at:658:169; Interrogation_Position=859; Antisense; AAAGGCTATTGCCTGTCAGCCGTGA
>probe:Drosophila_2:1628030_at:550:459; Interrogation_Position=886; Antisense; GATATTCTATGTGGAGTGCTCTCTG
>probe:Drosophila_2:1628030_at:462:535; Interrogation_Position=910; Antisense; GGTGCCCAATATGCCACTCATATAA
>probe:Drosophila_2:1628030_at:234:217; Interrogation_Position=968; Antisense; AAGTATTTATTGCTCTCGATCCAGA
>probe:Drosophila_2:1628030_at:7:295; Interrogation_Position=984; Antisense; CGATCCAGAATTTTTCTTGCCCAAC

Paste this into a BLAST search page for me
ATGACTTTTGTGGTCGCATCCAGAAATCCGGCTACCTGGCGAACTGGAGAGCGGGCTTTAGCCTATCCGAATAGTAAAGGCTGTGCGTAAAACCCATCGAAAAACCCATCGAGCTGGCTTTTGATTTTGTTCTAGACATGGCGACCAGCGTGTTTTCCCAGCTTGGCCTTAAGGAGGCCTTAAGGACACCATTACTATTTACTATTTCCTGCTGGTGGTCACAAAAAAGGCTATTGCCTGTCAGCCGTGAGATATTCTATGTGGAGTGCTCTCTGGGTGCCCAATATGCCACTCATATAAAAGTATTTATTGCTCTCGATCCAGACGATCCAGAATTTTTCTTGCCCAAC

Full Affymetrix probeset data:

Annotations for 1628030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720