Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628031_at:

>probe:Drosophila_2:1628031_at:376:83; Interrogation_Position=113; Antisense; AGTGGTATTCTTTTGAATCCCCTCG
>probe:Drosophila_2:1628031_at:540:43; Interrogation_Position=129; Antisense; ATCCCCTCGCGGCTTTAAGATACGT
>probe:Drosophila_2:1628031_at:103:97; Interrogation_Position=146; Antisense; AGATACGTGCGGCAGCTTCGGCTCC
>probe:Drosophila_2:1628031_at:364:715; Interrogation_Position=181; Antisense; TTGCCTAACCCATACATGCCACTTG
>probe:Drosophila_2:1628031_at:136:441; Interrogation_Position=226; Antisense; GATGGCTACTGTACGGTACTGTCTC
>probe:Drosophila_2:1628031_at:388:537; Interrogation_Position=240; Antisense; GGTACTGTCTCCTTTTAAATGTCGT
>probe:Drosophila_2:1628031_at:485:31; Interrogation_Position=286; Antisense; ATAATCGGAGTCATATCGGGCATCA
>probe:Drosophila_2:1628031_at:134:511; Interrogation_Position=29; Antisense; GGTTAAGGCAAAGCCTCGCAACTTT
>probe:Drosophila_2:1628031_at:462:23; Interrogation_Position=298; Antisense; ATATCGGGCATCAACGTCGGCCACA
>probe:Drosophila_2:1628031_at:726:203; Interrogation_Position=39; Antisense; AAGCCTCGCAACTTTGGCTGCAATA
>probe:Drosophila_2:1628031_at:496:573; Interrogation_Position=54; Antisense; GGCTGCAATACCAATTGCCATCGAT
>probe:Drosophila_2:1628031_at:240:627; Interrogation_Position=69; Antisense; TGCCATCGATGAGCCATTGATTGCT
>probe:Drosophila_2:1628031_at:299:315; Interrogation_Position=81; Antisense; GCCATTGATTGCTCAACTCGCAGAA
>probe:Drosophila_2:1628031_at:45:283; Interrogation_Position=97; Antisense; CTCGCAGAACGGATCAAGTGGTATT

Paste this into a BLAST search page for me
AGTGGTATTCTTTTGAATCCCCTCGATCCCCTCGCGGCTTTAAGATACGTAGATACGTGCGGCAGCTTCGGCTCCTTGCCTAACCCATACATGCCACTTGGATGGCTACTGTACGGTACTGTCTCGGTACTGTCTCCTTTTAAATGTCGTATAATCGGAGTCATATCGGGCATCAGGTTAAGGCAAAGCCTCGCAACTTTATATCGGGCATCAACGTCGGCCACAAAGCCTCGCAACTTTGGCTGCAATAGGCTGCAATACCAATTGCCATCGATTGCCATCGATGAGCCATTGATTGCTGCCATTGATTGCTCAACTCGCAGAACTCGCAGAACGGATCAAGTGGTATT

Full Affymetrix probeset data:

Annotations for 1628031_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime