FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628034_at:

>probe:Drosophila_2:1628034_at:695:467; Interrogation_Position=1050; Antisense; GTTCTTCAGGTACCGGGCATATCCA
>probe:Drosophila_2:1628034_at:588:569; Interrogation_Position=1065; Antisense; GGCATATCCACACTACAAGATCCTG
>probe:Drosophila_2:1628034_at:107:179; Interrogation_Position=1102; Antisense; AAACTCTCTGCCTGCTGAACATGGT
>probe:Drosophila_2:1628034_at:599:437; Interrogation_Position=1161; Antisense; GAGGACATTCGCACGGACATCAAGC
>probe:Drosophila_2:1628034_at:698:435; Interrogation_Position=1206; Antisense; GAGGTTCGCAGCATCAAGATTCCGC
>probe:Drosophila_2:1628034_at:148:583; Interrogation_Position=1262; Antisense; TGGCAAGGTCTTCGTCCAGTTCGAA
>probe:Drosophila_2:1628034_at:270:589; Interrogation_Position=1291; Antisense; TGGAGGATTCGCAGAAGGCCCTTAA
>probe:Drosophila_2:1628034_at:426:523; Interrogation_Position=1341; Antisense; GGGCGCATAGTGATGACCTCGTATT
>probe:Drosophila_2:1628034_at:532:705; Interrogation_Position=1364; Antisense; TTACGATCCCGAAAAGTACCTGGCG
>probe:Drosophila_2:1628034_at:89:383; Interrogation_Position=831; Antisense; GAACTGCTGCAGTCGTTTGGAGAAC
>probe:Drosophila_2:1628034_at:347:79; Interrogation_Position=901; Antisense; AGGGTTTCGCCTTCTTTGAGTACTG
>probe:Drosophila_2:1628034_at:378:541; Interrogation_Position=935; Antisense; GGTTACCGATCACGCCATAGCTGGA
>probe:Drosophila_2:1628034_at:324:27; Interrogation_Position=951; Antisense; ATAGCTGGATTGCACGGCATGCTGC
>probe:Drosophila_2:1628034_at:3:537; Interrogation_Position=995; Antisense; GGTCCAGAGATCTATTCCAGGCGGA

Paste this into a BLAST search page for me
GTTCTTCAGGTACCGGGCATATCCAGGCATATCCACACTACAAGATCCTGAAACTCTCTGCCTGCTGAACATGGTGAGGACATTCGCACGGACATCAAGCGAGGTTCGCAGCATCAAGATTCCGCTGGCAAGGTCTTCGTCCAGTTCGAATGGAGGATTCGCAGAAGGCCCTTAAGGGCGCATAGTGATGACCTCGTATTTTACGATCCCGAAAAGTACCTGGCGGAACTGCTGCAGTCGTTTGGAGAACAGGGTTTCGCCTTCTTTGAGTACTGGGTTACCGATCACGCCATAGCTGGAATAGCTGGATTGCACGGCATGCTGCGGTCCAGAGATCTATTCCAGGCGGA

Full Affymetrix probeset data:

Annotations for 1628034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720