FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628035_at:

>probe:Drosophila_2:1628035_at:219:13; Interrogation_Position=117; Antisense; ATTAACCGCAACCTCTTCGGATGAA
>probe:Drosophila_2:1628035_at:495:461; Interrogation_Position=182; Antisense; GTTCAGATTACGGACTTTCGGCCAT
>probe:Drosophila_2:1628035_at:494:541; Interrogation_Position=243; Antisense; GGTTGAGGCACAAGCGTATCGCAGT
>probe:Drosophila_2:1628035_at:57:461; Interrogation_Position=286; Antisense; GATTACAAGCTGCTACCCTGGGCAA
>probe:Drosophila_2:1628035_at:635:539; Interrogation_Position=30; Antisense; GGTTACAACCTCAACTAGAATCGGA
>probe:Drosophila_2:1628035_at:85:179; Interrogation_Position=316; Antisense; AAACAGCCCTTCTATGATTACATCA
>probe:Drosophila_2:1628035_at:244:513; Interrogation_Position=358; Antisense; GTGATCTCAAAAAACCTCGGCTACT
>probe:Drosophila_2:1628035_at:43:375; Interrogation_Position=403; Antisense; GAAGATAAATTTCAGCCTCCCTGGC
>probe:Drosophila_2:1628035_at:451:441; Interrogation_Position=469; Antisense; GATGGATTGCCGGAAATCGCTCCGC
>probe:Drosophila_2:1628035_at:84:283; Interrogation_Position=488; Antisense; CTCCGCCAGGATTCTACAAGATCGT
>probe:Drosophila_2:1628035_at:110:161; Interrogation_Position=520; Antisense; AAATTTGGTCCTGGGCAGCCAACTT
>probe:Drosophila_2:1628035_at:511:539; Interrogation_Position=547; Antisense; GGTTTCACAGCCGTTTTTAAGCTGA
>probe:Drosophila_2:1628035_at:190:19; Interrogation_Position=69; Antisense; ATTTCATTTGACAGCAGCATCACGA
>probe:Drosophila_2:1628035_at:409:525; Interrogation_Position=98; Antisense; GGGACTACGAGCCTATATTATTAAC

Paste this into a BLAST search page for me
ATTAACCGCAACCTCTTCGGATGAAGTTCAGATTACGGACTTTCGGCCATGGTTGAGGCACAAGCGTATCGCAGTGATTACAAGCTGCTACCCTGGGCAAGGTTACAACCTCAACTAGAATCGGAAAACAGCCCTTCTATGATTACATCAGTGATCTCAAAAAACCTCGGCTACTGAAGATAAATTTCAGCCTCCCTGGCGATGGATTGCCGGAAATCGCTCCGCCTCCGCCAGGATTCTACAAGATCGTAAATTTGGTCCTGGGCAGCCAACTTGGTTTCACAGCCGTTTTTAAGCTGAATTTCATTTGACAGCAGCATCACGAGGGACTACGAGCCTATATTATTAAC

Full Affymetrix probeset data:

Annotations for 1628035_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720