Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628036_at:

>probe:Drosophila_2:1628036_at:128:403; Interrogation_Position=1048; Antisense; GACTTGGATGGATTGACCTCCCACG
>probe:Drosophila_2:1628036_at:236:373; Interrogation_Position=1080; Antisense; GAAGTGCATTGCCTGTCAACAACAT
>probe:Drosophila_2:1628036_at:593:611; Interrogation_Position=1170; Antisense; TGAACCACGATCCATTAGCTACTTC
>probe:Drosophila_2:1628036_at:620:651; Interrogation_Position=1199; Antisense; TCAACATTCATTTGTCCGACCAGAC
>probe:Drosophila_2:1628036_at:716:197; Interrogation_Position=1265; Antisense; AACGTATCCTGGGACTTCGGGCTGA
>probe:Drosophila_2:1628036_at:245:339; Interrogation_Position=1326; Antisense; GCTAAAGTGGCGCTTTCTGCTGAAA
>probe:Drosophila_2:1628036_at:108:205; Interrogation_Position=1378; Antisense; AAGCCGGTGGGAGTGCGCAATCATC
>probe:Drosophila_2:1628036_at:477:359; Interrogation_Position=1394; Antisense; GCAATCATCTCGTCATTGTGGTCGT
>probe:Drosophila_2:1628036_at:427:595; Interrogation_Position=1410; Antisense; TGTGGTCGTCGACATGCAAGCCATT
>probe:Drosophila_2:1628036_at:556:9; Interrogation_Position=1432; Antisense; ATTCCCCTGGAAAAGCTTGTCGCAA
>probe:Drosophila_2:1628036_at:429:101; Interrogation_Position=906; Antisense; AGAGCTGGACAACATGCCTGCAGTT
>probe:Drosophila_2:1628036_at:692:399; Interrogation_Position=959; Antisense; GACAGATATATTCACGCGCCGAGGG
>probe:Drosophila_2:1628036_at:448:81; Interrogation_Position=980; Antisense; AGGGCGAACTGCAGGATCCGTCCAT
>probe:Drosophila_2:1628036_at:613:447; Interrogation_Position=994; Antisense; GATCCGTCCATACATCAGTTTACTG

Paste this into a BLAST search page for me
GACTTGGATGGATTGACCTCCCACGGAAGTGCATTGCCTGTCAACAACATTGAACCACGATCCATTAGCTACTTCTCAACATTCATTTGTCCGACCAGACAACGTATCCTGGGACTTCGGGCTGAGCTAAAGTGGCGCTTTCTGCTGAAAAAGCCGGTGGGAGTGCGCAATCATCGCAATCATCTCGTCATTGTGGTCGTTGTGGTCGTCGACATGCAAGCCATTATTCCCCTGGAAAAGCTTGTCGCAAAGAGCTGGACAACATGCCTGCAGTTGACAGATATATTCACGCGCCGAGGGAGGGCGAACTGCAGGATCCGTCCATGATCCGTCCATACATCAGTTTACTG

Full Affymetrix probeset data:

Annotations for 1628036_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime