Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628037_at:

>probe:Drosophila_2:1628037_at:362:113; Interrogation_Position=2951; Antisense; AGCAGCGCGCTGTGGCAAGATCTTG
>probe:Drosophila_2:1628037_at:608:451; Interrogation_Position=2969; Antisense; GATCTTGTGGACTATATGGCGCTGG
>probe:Drosophila_2:1628037_at:259:215; Interrogation_Position=3035; Antisense; AAGAGGCTCTACACTCATCAGGCAC
>probe:Drosophila_2:1628037_at:458:331; Interrogation_Position=3074; Antisense; GCGGAGCTCAAGGAGAACCCCTTTG
>probe:Drosophila_2:1628037_at:556:403; Interrogation_Position=3104; Antisense; GACTTTCCCATGACACCGAACGAGG
>probe:Drosophila_2:1628037_at:28:223; Interrogation_Position=3131; Antisense; AAGGGCGGCCTCAACGTATCGGAGC
>probe:Drosophila_2:1628037_at:218:593; Interrogation_Position=3159; Antisense; TGGTGTACAGCTGCTTGGCCGAACA
>probe:Drosophila_2:1628037_at:481:409; Interrogation_Position=3190; Antisense; GACGACGGCCATGGATGCGACTCTA
>probe:Drosophila_2:1628037_at:703:403; Interrogation_Position=3208; Antisense; GACTCTACGGGCAGAGCCATGGCAG
>probe:Drosophila_2:1628037_at:126:489; Interrogation_Position=3234; Antisense; GTACGCGCTGCGATTTCGAGCTGGA
>probe:Drosophila_2:1628037_at:162:553; Interrogation_Position=3274; Antisense; GGAGCAGCTGGTGCACCGATCCAAA
>probe:Drosophila_2:1628037_at:319:199; Interrogation_Position=3340; Antisense; AACGAGCACAGAGTCCTCAACGGAG
>probe:Drosophila_2:1628037_at:589:571; Interrogation_Position=3398; Antisense; GGCTATTACTGCAACTCCTGCAAGA
>probe:Drosophila_2:1628037_at:203:451; Interrogation_Position=3442; Antisense; GATCGACATTCTGCGCCACAAAAAG

Paste this into a BLAST search page for me
AGCAGCGCGCTGTGGCAAGATCTTGGATCTTGTGGACTATATGGCGCTGGAAGAGGCTCTACACTCATCAGGCACGCGGAGCTCAAGGAGAACCCCTTTGGACTTTCCCATGACACCGAACGAGGAAGGGCGGCCTCAACGTATCGGAGCTGGTGTACAGCTGCTTGGCCGAACAGACGACGGCCATGGATGCGACTCTAGACTCTACGGGCAGAGCCATGGCAGGTACGCGCTGCGATTTCGAGCTGGAGGAGCAGCTGGTGCACCGATCCAAAAACGAGCACAGAGTCCTCAACGGAGGGCTATTACTGCAACTCCTGCAAGAGATCGACATTCTGCGCCACAAAAAG

Full Affymetrix probeset data:

Annotations for 1628037_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime