FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628038_at:

>probe:Drosophila_2:1628038_at:494:113; Interrogation_Position=1009; Antisense; AGCAGCGGCAGGAACTTGGACTTGA
>probe:Drosophila_2:1628038_at:548:729; Interrogation_Position=1024; Antisense; TTGGACTTGAACCACGTCTGCGAGA
>probe:Drosophila_2:1628038_at:582:3; Interrogation_Position=1100; Antisense; ATTGGCAGGCCATCGAGACTATTTG
>probe:Drosophila_2:1628038_at:663:439; Interrogation_Position=1170; Antisense; GATGGAACCTCCATCCTTGGATGAT
>probe:Drosophila_2:1628038_at:219:313; Interrogation_Position=692; Antisense; GCCAGCCGTCGACCAGTAAAAGTAA
>probe:Drosophila_2:1628038_at:351:627; Interrogation_Position=717; Antisense; TCCATGCCAGATTCCGAAGATTCCG
>probe:Drosophila_2:1628038_at:55:375; Interrogation_Position=732; Antisense; GAAGATTCCGAATCTGCCGTCCGGA
>probe:Drosophila_2:1628038_at:482:441; Interrogation_Position=755; Antisense; GATGGACAGCTTCGCCGAGCAAAGA
>probe:Drosophila_2:1628038_at:346:149; Interrogation_Position=785; Antisense; ACTTCCCTTTCATGGCGGATCTGGA
>probe:Drosophila_2:1628038_at:275:535; Interrogation_Position=822; Antisense; GGTCGAAAGTCTGATGCCCGAGCTG
>probe:Drosophila_2:1628038_at:70:109; Interrogation_Position=881; Antisense; AGAATTCTCCGCCTTGGGACTTGTA
>probe:Drosophila_2:1628038_at:383:315; Interrogation_Position=907; Antisense; GCCTTGATGGGCAACGACGACAAAT
>probe:Drosophila_2:1628038_at:172:409; Interrogation_Position=922; Antisense; GACGACAAATTTCCGCTTAGCATCT
>probe:Drosophila_2:1628038_at:346:523; Interrogation_Position=981; Antisense; GGGCTCCACTTGCATTAACTGGGAA

Paste this into a BLAST search page for me
AGCAGCGGCAGGAACTTGGACTTGATTGGACTTGAACCACGTCTGCGAGAATTGGCAGGCCATCGAGACTATTTGGATGGAACCTCCATCCTTGGATGATGCCAGCCGTCGACCAGTAAAAGTAATCCATGCCAGATTCCGAAGATTCCGGAAGATTCCGAATCTGCCGTCCGGAGATGGACAGCTTCGCCGAGCAAAGAACTTCCCTTTCATGGCGGATCTGGAGGTCGAAAGTCTGATGCCCGAGCTGAGAATTCTCCGCCTTGGGACTTGTAGCCTTGATGGGCAACGACGACAAATGACGACAAATTTCCGCTTAGCATCTGGGCTCCACTTGCATTAACTGGGAA

Full Affymetrix probeset data:

Annotations for 1628038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720