FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628040_at:

>probe:Drosophila_2:1628040_at:224:715; Interrogation_Position=125; Antisense; TTCTCTTATAAGACGCAGCCAGATG
>probe:Drosophila_2:1628040_at:284:73; Interrogation_Position=171; Antisense; AGGCACATACCTCGGATGACGGCGA
>probe:Drosophila_2:1628040_at:253:211; Interrogation_Position=230; Antisense; AAGAAGGGTGTCATCTACATATCCA
>probe:Drosophila_2:1628040_at:153:91; Interrogation_Position=303; Antisense; AGTACGGTGCCATCGGCAGAGCTTT
>probe:Drosophila_2:1628040_at:432:305; Interrogation_Position=328; Antisense; CCTGCGGTCGCAGAAGCTGTCAAGA
>probe:Drosophila_2:1628040_at:66:393; Interrogation_Position=351; Antisense; GAAAGCCTCATAATTTCCTCTTCGC
>probe:Drosophila_2:1628040_at:198:95; Interrogation_Position=444; Antisense; AGATATCCACGCACAAGAAGTCCCC
>probe:Drosophila_2:1628040_at:501:373; Interrogation_Position=460; Antisense; GAAGTCCCCATTTTATTACTCACTG
>probe:Drosophila_2:1628040_at:607:649; Interrogation_Position=479; Antisense; TCACTGTGGATCATGGAGTACCTGC
>probe:Drosophila_2:1628040_at:640:1; Interrogation_Position=513; Antisense; AGTGGGCCCGTCTAAACGAACTCAT
>probe:Drosophila_2:1628040_at:262:385; Interrogation_Position=530; Antisense; GAACTCATGAACATCGTGCCGGTCA
>probe:Drosophila_2:1628040_at:236:371; Interrogation_Position=625; Antisense; GAAGGCTCTGGCTGACAGACTTCTT
>probe:Drosophila_2:1628040_at:720:103; Interrogation_Position=641; Antisense; AGACTTCTTGAGTTAGTGCTAGCCT
>probe:Drosophila_2:1628040_at:318:339; Interrogation_Position=658; Antisense; GCTAGCCTCTAGCATCTAATGTTAA

Paste this into a BLAST search page for me
TTCTCTTATAAGACGCAGCCAGATGAGGCACATACCTCGGATGACGGCGAAAGAAGGGTGTCATCTACATATCCAAGTACGGTGCCATCGGCAGAGCTTTCCTGCGGTCGCAGAAGCTGTCAAGAGAAAGCCTCATAATTTCCTCTTCGCAGATATCCACGCACAAGAAGTCCCCGAAGTCCCCATTTTATTACTCACTGTCACTGTGGATCATGGAGTACCTGCAGTGGGCCCGTCTAAACGAACTCATGAACTCATGAACATCGTGCCGGTCAGAAGGCTCTGGCTGACAGACTTCTTAGACTTCTTGAGTTAGTGCTAGCCTGCTAGCCTCTAGCATCTAATGTTAA

Full Affymetrix probeset data:

Annotations for 1628040_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720