FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628042_at:

>probe:Drosophila_2:1628042_at:558:617; Interrogation_Position=1026; Antisense; TGCTACGGCCTGTCTTCAATGTCAC
>probe:Drosophila_2:1628042_at:610:141; Interrogation_Position=524; Antisense; ACATGGCCAAGCTGGTTCGAACCGG
>probe:Drosophila_2:1628042_at:111:117; Interrogation_Position=550; Antisense; AGCTATCTGCTGAATCCCGATGTCA
>probe:Drosophila_2:1628042_at:255:17; Interrogation_Position=574; Antisense; ATTTTTCTCGGCACCTGTTTAGATG
>probe:Drosophila_2:1628042_at:626:127; Interrogation_Position=646; Antisense; ACCTTGGCGGCCATGAAAGCCTATA
>probe:Drosophila_2:1628042_at:62:299; Interrogation_Position=680; Antisense; CGCCGCTGGTGCTGGGAAAACCCAA
>probe:Drosophila_2:1628042_at:83:441; Interrogation_Position=711; Antisense; GATGGCGTCTACACTCATGCAGTCC
>probe:Drosophila_2:1628042_at:253:595; Interrogation_Position=767; Antisense; TGGGCGATACACTGCAGACGGATAT
>probe:Drosophila_2:1628042_at:254:105; Interrogation_Position=782; Antisense; AGACGGATATGCACTTCGCTTCCAA
>probe:Drosophila_2:1628042_at:508:717; Interrogation_Position=796; Antisense; TTCGCTTCCAACTGTGGTTTCCAAT
>probe:Drosophila_2:1628042_at:21:541; Interrogation_Position=811; Antisense; GGTTTCCAATCCCTGATGGTCGGCA
>probe:Drosophila_2:1628042_at:425:65; Interrogation_Position=826; Antisense; ATGGTCGGCAGTGGTGTGAACACCC
>probe:Drosophila_2:1628042_at:481:95; Interrogation_Position=866; Antisense; AGATCATCGAGGAGGGTGACCCCAA
>probe:Drosophila_2:1628042_at:363:153; Interrogation_Position=935; Antisense; ACATGCTGGAGTTCCTCTGCTAGAC

Paste this into a BLAST search page for me
TGCTACGGCCTGTCTTCAATGTCACACATGGCCAAGCTGGTTCGAACCGGAGCTATCTGCTGAATCCCGATGTCAATTTTTCTCGGCACCTGTTTAGATGACCTTGGCGGCCATGAAAGCCTATACGCCGCTGGTGCTGGGAAAACCCAAGATGGCGTCTACACTCATGCAGTCCTGGGCGATACACTGCAGACGGATATAGACGGATATGCACTTCGCTTCCAATTCGCTTCCAACTGTGGTTTCCAATGGTTTCCAATCCCTGATGGTCGGCAATGGTCGGCAGTGGTGTGAACACCCAGATCATCGAGGAGGGTGACCCCAAACATGCTGGAGTTCCTCTGCTAGAC

Full Affymetrix probeset data:

Annotations for 1628042_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720