FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628044_at:

>probe:Drosophila_2:1628044_at:271:511; Interrogation_Position=394; Antisense; GTGAATCTCGAAGAAGCCTCCAATC
>probe:Drosophila_2:1628044_at:322:239; Interrogation_Position=415; Antisense; AATCTAGTGCTATCCTATCTCGAGA
>probe:Drosophila_2:1628044_at:452:375; Interrogation_Position=438; Antisense; GAAGAACATACCAAAGCGCGCCTGT
>probe:Drosophila_2:1628044_at:422:713; Interrogation_Position=467; Antisense; TTGGTGGGAACTCCGTCTACACCGA
>probe:Drosophila_2:1628044_at:359:665; Interrogation_Position=484; Antisense; TACACCGACCGACTATTCATTATGA
>probe:Drosophila_2:1628044_at:205:675; Interrogation_Position=524; Antisense; TAGATGCTTACCTGCATTACCGCAT
>probe:Drosophila_2:1628044_at:227:43; Interrogation_Position=547; Antisense; ATCGTCGATGTGTCCACCATCAAGG
>probe:Drosophila_2:1628044_at:36:441; Interrogation_Position=584; Antisense; GATGGCATCCCGCAATTCTGGATTC
>probe:Drosophila_2:1628044_at:289:463; Interrogation_Position=604; Antisense; GATTCCGCTCCCAAAAAATCTTTCA
>probe:Drosophila_2:1628044_at:632:37; Interrogation_Position=621; Antisense; ATCTTTCACGCATCGTAGTCTGGAC
>probe:Drosophila_2:1628044_at:312:587; Interrogation_Position=641; Antisense; TGGACGACATCCGAGAAAGCATCAA
>probe:Drosophila_2:1628044_at:660:207; Interrogation_Position=720; Antisense; AAGCACCCTAGGAATTCTTTCAATA
>probe:Drosophila_2:1628044_at:694:657; Interrogation_Position=787; Antisense; TAAAAGTCCGCGTTGTATTGTTAAG
>probe:Drosophila_2:1628044_at:633:703; Interrogation_Position=874; Antisense; TTAGTGTATTTTCCGTATATGCACG

Paste this into a BLAST search page for me
GTGAATCTCGAAGAAGCCTCCAATCAATCTAGTGCTATCCTATCTCGAGAGAAGAACATACCAAAGCGCGCCTGTTTGGTGGGAACTCCGTCTACACCGATACACCGACCGACTATTCATTATGATAGATGCTTACCTGCATTACCGCATATCGTCGATGTGTCCACCATCAAGGGATGGCATCCCGCAATTCTGGATTCGATTCCGCTCCCAAAAAATCTTTCAATCTTTCACGCATCGTAGTCTGGACTGGACGACATCCGAGAAAGCATCAAAAGCACCCTAGGAATTCTTTCAATATAAAAGTCCGCGTTGTATTGTTAAGTTAGTGTATTTTCCGTATATGCACG

Full Affymetrix probeset data:

Annotations for 1628044_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720