Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628045_s_at:

>probe:Drosophila_2:1628045_s_at:517:551; Interrogation_Position=387; Antisense; GGAGCTAATTTACTGCGGCAAGGAT
>probe:Drosophila_2:1628045_s_at:396:251; Interrogation_Position=405; Antisense; CAAGGATCGCAGCTGCAATCGGAAT
>probe:Drosophila_2:1628045_s_at:118:361; Interrogation_Position=426; Antisense; GAATATAACCCCAACTAGTGTCCTT
>probe:Drosophila_2:1628045_s_at:679:147; Interrogation_Position=439; Antisense; ACTAGTGTCCTTTTTGCGGAGCAAA
>probe:Drosophila_2:1628045_s_at:461:213; Interrogation_Position=484; Antisense; AAGAGCCTCCATCTGGGATGCGAAC
>probe:Drosophila_2:1628045_s_at:623:513; Interrogation_Position=616; Antisense; GTGTTCAACGTGTATGCCCGCAGCA
>probe:Drosophila_2:1628045_s_at:651:115; Interrogation_Position=637; Antisense; AGCATATTTCCCTGTGATCCGCACA
>probe:Drosophila_2:1628045_s_at:157:233; Interrogation_Position=666; Antisense; AATCGGTGTCCTGTACGAGTATCCT
>probe:Drosophila_2:1628045_s_at:161:431; Interrogation_Position=682; Antisense; GAGTATCCTGGCTGCATTCTCGAGC
>probe:Drosophila_2:1628045_s_at:526:131; Interrogation_Position=713; Antisense; ACCGGGTGCGTCTTTATGCTAGGCT
>probe:Drosophila_2:1628045_s_at:273:121; Interrogation_Position=794; Antisense; AGCGGGTCGTCAAGAGCCAGCATTC
>probe:Drosophila_2:1628045_s_at:659:675; Interrogation_Position=857; Antisense; TAGAGTACTGCTTCGTCTACGTCAG
>probe:Drosophila_2:1628045_s_at:315:125; Interrogation_Position=880; Antisense; AGCCAGGCAATTTCCGGAGCCGTAG
>probe:Drosophila_2:1628045_s_at:495:441; Interrogation_Position=907; Antisense; GATGTCCGGATGGACTGTGTGCCCA

Paste this into a BLAST search page for me
GGAGCTAATTTACTGCGGCAAGGATCAAGGATCGCAGCTGCAATCGGAATGAATATAACCCCAACTAGTGTCCTTACTAGTGTCCTTTTTGCGGAGCAAAAAGAGCCTCCATCTGGGATGCGAACGTGTTCAACGTGTATGCCCGCAGCAAGCATATTTCCCTGTGATCCGCACAAATCGGTGTCCTGTACGAGTATCCTGAGTATCCTGGCTGCATTCTCGAGCACCGGGTGCGTCTTTATGCTAGGCTAGCGGGTCGTCAAGAGCCAGCATTCTAGAGTACTGCTTCGTCTACGTCAGAGCCAGGCAATTTCCGGAGCCGTAGGATGTCCGGATGGACTGTGTGCCCA

Full Affymetrix probeset data:

Annotations for 1628045_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime