Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628049_at:

>probe:Drosophila_2:1628049_at:697:579; Interrogation_Position=12605; Antisense; TGGCCGACACGGAGTTTGACTTTGA
>probe:Drosophila_2:1628049_at:671:621; Interrogation_Position=12644; Antisense; TGCGACACTTCTTTGGCTTGGACAG
>probe:Drosophila_2:1628049_at:289:589; Interrogation_Position=12674; Antisense; TGGTCTATTCAAAGCGGTTCCCCGA
>probe:Drosophila_2:1628049_at:406:355; Interrogation_Position=12716; Antisense; GCAACACAACCCACATTCCGAAGAG
>probe:Drosophila_2:1628049_at:168:593; Interrogation_Position=12746; Antisense; TGGGAATCTGTACAACGCTAGCGGT
>probe:Drosophila_2:1628049_at:639:81; Interrogation_Position=12779; Antisense; AGGGATCTGTGTTCAGTGCCCGCAA
>probe:Drosophila_2:1628049_at:339:91; Interrogation_Position=12821; Antisense; AGTATCCGATCAAGCGATTCGCCAC
>probe:Drosophila_2:1628049_at:569:463; Interrogation_Position=12836; Antisense; GATTCGCCACAATTTTCGCCAAACG
>probe:Drosophila_2:1628049_at:500:175; Interrogation_Position=12856; Antisense; AAACGGGTCGCCTTGAGTGCCACGC
>probe:Drosophila_2:1628049_at:146:453; Interrogation_Position=12973; Antisense; GATCTAGACGACTATGACTCCTTCA
>probe:Drosophila_2:1628049_at:555:403; Interrogation_Position=12988; Antisense; GACTCCTTCAATAACTGGGACTGGG
>probe:Drosophila_2:1628049_at:216:499; Interrogation_Position=13044; Antisense; GTCGTAGTTTATAGTCCGCCACAAT
>probe:Drosophila_2:1628049_at:560:503; Interrogation_Position=13057; Antisense; GTCCGCCACAATTAGTTAGCTAGTT
>probe:Drosophila_2:1628049_at:423:341; Interrogation_Position=13075; Antisense; GCTAGTTCAGTTATGTCCGTGCAGA

Paste this into a BLAST search page for me
TGGCCGACACGGAGTTTGACTTTGATGCGACACTTCTTTGGCTTGGACAGTGGTCTATTCAAAGCGGTTCCCCGAGCAACACAACCCACATTCCGAAGAGTGGGAATCTGTACAACGCTAGCGGTAGGGATCTGTGTTCAGTGCCCGCAAAGTATCCGATCAAGCGATTCGCCACGATTCGCCACAATTTTCGCCAAACGAAACGGGTCGCCTTGAGTGCCACGCGATCTAGACGACTATGACTCCTTCAGACTCCTTCAATAACTGGGACTGGGGTCGTAGTTTATAGTCCGCCACAATGTCCGCCACAATTAGTTAGCTAGTTGCTAGTTCAGTTATGTCCGTGCAGA

Full Affymetrix probeset data:

Annotations for 1628049_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime