FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628051_at:

>probe:Drosophila_2:1628051_at:683:391; Interrogation_Position=235; Antisense; GAAAGGTCAAAACAGCGCAGCCCAA
>probe:Drosophila_2:1628051_at:549:125; Interrogation_Position=261; Antisense; ACGTAAATCCCTGCCACAAGGACTG
>probe:Drosophila_2:1628051_at:136:101; Interrogation_Position=293; Antisense; AGAGAGGAGTCTTTTGCGGCAGCCC
>probe:Drosophila_2:1628051_at:242:107; Interrogation_Position=339; Antisense; AGAACCGCCGGTGGAGCAACAACTA
>probe:Drosophila_2:1628051_at:10:413; Interrogation_Position=390; Antisense; GACCAGTTGCCAAACCGGATGAGAT
>probe:Drosophila_2:1628051_at:51:199; Interrogation_Position=449; Antisense; AACGCGGCCAGGAGGCGGAACTTCA
>probe:Drosophila_2:1628051_at:674:287; Interrogation_Position=464; Antisense; CGGAACTTCAAGTCGGCGCAGGTGT
>probe:Drosophila_2:1628051_at:579:349; Interrogation_Position=481; Antisense; GCAGGTGTCCCAATACCAGCAGAGG
>probe:Drosophila_2:1628051_at:135:71; Interrogation_Position=546; Antisense; AGGCCGAGGAGCACGACTACGAGTC
>probe:Drosophila_2:1628051_at:459:609; Interrogation_Position=655; Antisense; TGAGCAGGAGCTTCTCCAACGCGTG
>probe:Drosophila_2:1628051_at:24:123; Interrogation_Position=683; Antisense; AGCGCCTCCAAGCAAACGGAACGTT
>probe:Drosophila_2:1628051_at:232:393; Interrogation_Position=732; Antisense; GAAAGGTCATCTCGCCATACAACTC
>probe:Drosophila_2:1628051_at:385:429; Interrogation_Position=785; Antisense; GAGTTCCGGCACAACATGATCTTTG
>probe:Drosophila_2:1628051_at:605:449; Interrogation_Position=802; Antisense; GATCTTTGGCCGTACGAGTTACTGA

Paste this into a BLAST search page for me
GAAAGGTCAAAACAGCGCAGCCCAAACGTAAATCCCTGCCACAAGGACTGAGAGAGGAGTCTTTTGCGGCAGCCCAGAACCGCCGGTGGAGCAACAACTAGACCAGTTGCCAAACCGGATGAGATAACGCGGCCAGGAGGCGGAACTTCACGGAACTTCAAGTCGGCGCAGGTGTGCAGGTGTCCCAATACCAGCAGAGGAGGCCGAGGAGCACGACTACGAGTCTGAGCAGGAGCTTCTCCAACGCGTGAGCGCCTCCAAGCAAACGGAACGTTGAAAGGTCATCTCGCCATACAACTCGAGTTCCGGCACAACATGATCTTTGGATCTTTGGCCGTACGAGTTACTGA

Full Affymetrix probeset data:

Annotations for 1628051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720