FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628052_at:

>probe:Drosophila_2:1628052_at:38:467; Interrogation_Position=1019; Antisense; GATTGGCAATGTGTTCGGCAAGCAT
>probe:Drosophila_2:1628052_at:112:201; Interrogation_Position=1106; Antisense; AACGCTGCGAAAGTACCCAGTACTG
>probe:Drosophila_2:1628052_at:52:301; Interrogation_Position=1121; Antisense; CCCAGTACTGGCTCATCTTACAAGA
>probe:Drosophila_2:1628052_at:619:107; Interrogation_Position=1143; Antisense; AGAATGACTGACACCGACTTTTCGC
>probe:Drosophila_2:1628052_at:604:117; Interrogation_Position=1217; Antisense; AGCTTTGGGCATTCACTATGATCCG
>probe:Drosophila_2:1628052_at:27:127; Interrogation_Position=1270; Antisense; AGCCAGAACGCTTTACCGACGAGGA
>probe:Drosophila_2:1628052_at:169:511; Interrogation_Position=1313; Antisense; GTGCACTTGGCTTCCATTTGGAGAA
>probe:Drosophila_2:1628052_at:665:443; Interrogation_Position=1373; Antisense; GATGCAAACCTGTGTGGGCTTGGCC
>probe:Drosophila_2:1628052_at:305:339; Interrogation_Position=1411; Antisense; GCTATAAATTCAGTGTTTCCCCGGA
>probe:Drosophila_2:1628052_at:428:657; Interrogation_Position=1463; Antisense; TAAGAACATTCTGATATCGGCCGAG
>probe:Drosophila_2:1628052_at:527:35; Interrogation_Position=1478; Antisense; ATCGGCCGAGAATGGTATCCACCTT
>probe:Drosophila_2:1628052_at:2:553; Interrogation_Position=1508; Antisense; GGAGAAGCTCGCCAAATAAGTTTTT
>probe:Drosophila_2:1628052_at:275:137; Interrogation_Position=951; Antisense; ACGACCATGGGATTCGCTCTATATG
>probe:Drosophila_2:1628052_at:154:339; Interrogation_Position=966; Antisense; GCTCTATATGAGCTGGCCAGGAACC

Paste this into a BLAST search page for me
GATTGGCAATGTGTTCGGCAAGCATAACGCTGCGAAAGTACCCAGTACTGCCCAGTACTGGCTCATCTTACAAGAAGAATGACTGACACCGACTTTTCGCAGCTTTGGGCATTCACTATGATCCGAGCCAGAACGCTTTACCGACGAGGAGTGCACTTGGCTTCCATTTGGAGAAGATGCAAACCTGTGTGGGCTTGGCCGCTATAAATTCAGTGTTTCCCCGGATAAGAACATTCTGATATCGGCCGAGATCGGCCGAGAATGGTATCCACCTTGGAGAAGCTCGCCAAATAAGTTTTTACGACCATGGGATTCGCTCTATATGGCTCTATATGAGCTGGCCAGGAACC

Full Affymetrix probeset data:

Annotations for 1628052_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720