FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628053_at:

>probe:Drosophila_2:1628053_at:331:249; Interrogation_Position=1679; Antisense; CAATCCCTATCTGCTCGAGGAGATC
>probe:Drosophila_2:1628053_at:441:97; Interrogation_Position=1699; Antisense; AGATCCCCAAGTGGTTGGCCGTCTA
>probe:Drosophila_2:1628053_at:346:93; Interrogation_Position=1759; Antisense; AGTTCAACATGTTTAGCCTGCCGGA
>probe:Drosophila_2:1628053_at:645:153; Interrogation_Position=1798; Antisense; ACAGCATGCTGGTGCGGCTCTTCAA
>probe:Drosophila_2:1628053_at:251:651; Interrogation_Position=1819; Antisense; TCAAGCAGGAACTGGGCACCATCGT
>probe:Drosophila_2:1628053_at:677:131; Interrogation_Position=1861; Antisense; ACCGTCGCGCTTTGATACTCGAGAA
>probe:Drosophila_2:1628053_at:485:265; Interrogation_Position=1920; Antisense; CAGTGACCCGGTGACCAGGTGACGA
>probe:Drosophila_2:1628053_at:265:535; Interrogation_Position=1937; Antisense; GGTGACGACTGACTCAGACCACATA
>probe:Drosophila_2:1628053_at:621:667; Interrogation_Position=1960; Antisense; TACTCGCCAGCAGCTATATGCACAT
>probe:Drosophila_2:1628053_at:629:677; Interrogation_Position=1987; Antisense; TAGTGCTCCTGTAATCGACCTTTAA
>probe:Drosophila_2:1628053_at:12:149; Interrogation_Position=2011; Antisense; ACTTATTTAACCATCGACTCATCGC
>probe:Drosophila_2:1628053_at:73:405; Interrogation_Position=2026; Antisense; GACTCATCGCGAAATCAGTGCCTTA
>probe:Drosophila_2:1628053_at:323:449; Interrogation_Position=2081; Antisense; GATCCATGACAGTTCGAATGCCTTG
>probe:Drosophila_2:1628053_at:606:693; Interrogation_Position=2150; Antisense; TTTGAGCTTGGCGTTTGTTTGTAAT

Paste this into a BLAST search page for me
CAATCCCTATCTGCTCGAGGAGATCAGATCCCCAAGTGGTTGGCCGTCTAAGTTCAACATGTTTAGCCTGCCGGAACAGCATGCTGGTGCGGCTCTTCAATCAAGCAGGAACTGGGCACCATCGTACCGTCGCGCTTTGATACTCGAGAACAGTGACCCGGTGACCAGGTGACGAGGTGACGACTGACTCAGACCACATATACTCGCCAGCAGCTATATGCACATTAGTGCTCCTGTAATCGACCTTTAAACTTATTTAACCATCGACTCATCGCGACTCATCGCGAAATCAGTGCCTTAGATCCATGACAGTTCGAATGCCTTGTTTGAGCTTGGCGTTTGTTTGTAAT

Full Affymetrix probeset data:

Annotations for 1628053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720