Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1628055_at:

>probe:Drosophila_2:1628055_at:52:443; Interrogation_Position=1030; Antisense; GATGTTTTTACCATGCAGCTGAGGC
>probe:Drosophila_2:1628055_at:450:3; Interrogation_Position=1084; Antisense; ATTGTGGAGCTGGACAAACCCGCTT
>probe:Drosophila_2:1628055_at:257:175; Interrogation_Position=1099; Antisense; AAACCCGCTTGCCTTAGTTATATTG
>probe:Drosophila_2:1628055_at:127:573; Interrogation_Position=1123; Antisense; GGCTCCATTCTGAGCAACGTCATTA
>probe:Drosophila_2:1628055_at:469:497; Interrogation_Position=1141; Antisense; GTCATTATCCTCATGCAGTTCGATT
>probe:Drosophila_2:1628055_at:598:407; Interrogation_Position=1169; Antisense; GACGGCAAAGACAACCCATCAATGA
>probe:Drosophila_2:1628055_at:27:607; Interrogation_Position=1191; Antisense; TGATCGTCAATATCTCATCCATTTG
>probe:Drosophila_2:1628055_at:196:41; Interrogation_Position=644; Antisense; ATCTGGCCATAAACGCTCTTCATGG
>probe:Drosophila_2:1628055_at:524:227; Interrogation_Position=686; Antisense; AATGGAAAGCTCTGCGTTCCGTAGC
>probe:Drosophila_2:1628055_at:193:315; Interrogation_Position=712; Antisense; GCCATGCATCTGAAAACCCTTCGAT
>probe:Drosophila_2:1628055_at:32:603; Interrogation_Position=758; Antisense; TGTTTGACATCGCTAATGCCACGGT
>probe:Drosophila_2:1628055_at:215:655; Interrogation_Position=810; Antisense; TAATATCCTTTATCATGCCGTCCAG
>probe:Drosophila_2:1628055_at:62:543; Interrogation_Position=886; Antisense; GGATTGATCGTTTTCAACTTCTGGG
>probe:Drosophila_2:1628055_at:519:25; Interrogation_Position=938; Antisense; ATAGTGTGGTGACCTCCTGCAACAA

Paste this into a BLAST search page for me
GATGTTTTTACCATGCAGCTGAGGCATTGTGGAGCTGGACAAACCCGCTTAAACCCGCTTGCCTTAGTTATATTGGGCTCCATTCTGAGCAACGTCATTAGTCATTATCCTCATGCAGTTCGATTGACGGCAAAGACAACCCATCAATGATGATCGTCAATATCTCATCCATTTGATCTGGCCATAAACGCTCTTCATGGAATGGAAAGCTCTGCGTTCCGTAGCGCCATGCATCTGAAAACCCTTCGATTGTTTGACATCGCTAATGCCACGGTTAATATCCTTTATCATGCCGTCCAGGGATTGATCGTTTTCAACTTCTGGGATAGTGTGGTGACCTCCTGCAACAA

Full Affymetrix probeset data:

Annotations for 1628055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime